EMAIL THIS PAGE TO A FRIEND

GIMAP2

GTPase, IMAP family member 2

Synonyms: HIMAP2 IMAP2
UniProtKB ID: Q9UG22, Q96L25
Gene ID:
Human(26157) Summary: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
dog(482797) GTPase, IMAP family member 2
cow(528154) GTPase, IMAP family member 2
domestic cat(101100797) GTPase, IMAP family member 2
sheep(101111797) GTPase, IMAP family member 2
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015660 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160411 MISSION® esiRNA esiRNA human GIMAP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015660 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179290 predicted 670
2 SASI_Hs01_00179291 predicted 1145
3 SASI_Hs02_00348281 predicted 1094
4 SASI_Hs01_00179292 predicted 791
5 SASI_Hs01_00179293 predicted 614
6 SASI_Hs01_00179294 predicted 1096
7 SASI_Hs01_00179295 predicted 1050
8 SASI_Hs01_00179296 predicted 728
9 SASI_Hs02_00348282 predicted 828
10 SASI_Hs01_00179297 predicted 686
11 SASI_Hs01_00179298 predicted 654
12 SASI_Hs01_00179299 predicted 1001
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015660
GIMAP2 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-629s1c1
Sequence:CCGGGCCTTTAATAACCGTGCTGAACTCGAGTTCAGCACGGTTATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-249s1c1
Sequence:CCGGCCCAGACCTTGACTAAGACTTCTCGAGAAGTCTTAGTCAAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-745s1c1
Sequence:CCGGCAGCCTAATACAGAGGTCTAACTCGAGTTAGACCTCTGTATTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-988s1c1
Sequence:CCGGCTTACTCTTTAGTATGTGCAACTCGAGTTGCACATACTAAAGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-310s1c1
Sequence:CCGGCATTATTGACACACCAGATATCTCGAGATATCTGGTGTGTCAATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015660
GIMAP2 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-629s1c1
Sequence:CCGGGCCTTTAATAACCGTGCTGAACTCGAGTTCAGCACGGTTATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-249s1c1
Sequence:CCGGCCCAGACCTTGACTAAGACTTCTCGAGAAGTCTTAGTCAAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-745s1c1
Sequence:CCGGCAGCCTAATACAGAGGTCTAACTCGAGTTAGACCTCTGTATTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-988s1c1
Sequence:CCGGCTTACTCTTTAGTATGTGCAACTCGAGTTGCACATACTAAAGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-310s1c1
Sequence:CCGGCATTATTGACACACCAGATATCTCGAGATATCTGGTGTGTCAATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015660
GIMAP2 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-629s1c1
Sequence:CCGGGCCTTTAATAACCGTGCTGAACTCGAGTTCAGCACGGTTATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-249s1c1
Sequence:CCGGCCCAGACCTTGACTAAGACTTCTCGAGAAGTCTTAGTCAAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-745s1c1
Sequence:CCGGCAGCCTAATACAGAGGTCTAACTCGAGTTAGACCTCTGTATTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-988s1c1
Sequence:CCGGCTTACTCTTTAGTATGTGCAACTCGAGTTGCACATACTAAAGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015660.1-310s1c1
Sequence:CCGGCATTATTGACACACCAGATATCTCGAGATATCTGGTGTGTCAATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks