EMAIL THIS PAGE TO A FRIEND

GIMAP4

GTPase, IMAP family member 4

Synonyms: IAN-1 IAN1 IMAP4
UniProtKB ID: Q9NUV9
Gene ID:
Human(55303) Summary: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The encoded protein of this gene may be negatively regulated by T-cell acute lymphocytic leukemia 1 (TAL1). In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Mouse(107526) GTPase, IMAP family member 4
Rat(286938) GTPase, IMAP family member 4
dog(475533) GTPase, IMAP family member 4
cow(510751) GTPase, IMAP family member 4
domestic cat(101101043) GTPase, IMAP family member 4
domestic guinea pig(100733127) GTPase, IMAP family member 4
naked mole-rat(101724503) GTPase, IMAP family member 4
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018951 MISSION® esiRNA esiRNA targeting human GIMAP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018326 Rosetta Predictions human pricing
NM_173153 Rosetta Predictions rat pricing
NM_174990 Rosetta Predictions mouse pricing
NM_175048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035125 predicted 1115
2 SASI_Hs01_00035126 predicted 318
3 SASI_Hs01_00035127 predicted 869
4 SASI_Hs01_00035128 predicted 1062
5 SASI_Hs01_00035129 predicted 983
6 SASI_Hs01_00035130 predicted 729
7 SASI_Hs01_00035131 predicted 532
8 SASI_Hs01_00035132 predicted 541
9 SASI_Hs01_00035133 predicted 322
10 SASI_Hs01_00035134 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047847 predicted 523
2 SASI_Rn01_00047848 predicted 807
3 SASI_Rn01_00047849 predicted 719
4 SASI_Rn01_00047851 predicted 354
5 SASI_Rn01_00047852 predicted 1048
6 SASI_Rn01_00047853 predicted 878
7 SASI_Rn01_00047854 predicted 450
8 SASI_Rn01_00047855 predicted 446
9 SASI_Rn01_00047856 predicted 801
10 SASI_Rn02_00269347 predicted 871
11 SASI_Rn01_00047850 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188286 predicted 1374
2 SASI_Mm01_00188280 predicted 1459
3 SASI_Mm01_00188281 predicted 1445
4 SASI_Mm01_00188282 predicted 1435
5 SASI_Mm01_00188283 predicted 1431
6 SASI_Mm02_00345530 predicted 1442
7 SASI_Mm02_00345531 predicted 1421
8 SASI_Mm02_00345532 predicted 1462
9 SASI_Mm01_00188279 predicted 1486
10 SASI_Mm01_00188284 predicted 1489
11 SASI_Mm01_00188285 predicted 1406
12 SASI_Mm01_00188287 predicted 1046
13 SASI_Mm01_00188288 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345649 predicted 529
2 SASI_Mm01_00196686 predicted 606
3 SASI_Mm01_00196687 predicted 597
4 SASI_Mm01_00196689 predicted 739
5 SASI_Mm01_00196690 predicted 584
6 SASI_Mm01_00196691 predicted 716
7 SASI_Mm01_00196692 predicted 579
8 SASI_Mm02_00345650 predicted 595
9 SASI_Mm02_00345651 predicted 580
10 SASI_Mm02_00345652 predicted 610
11 SASI_Mm01_00196685 predicted 642
12 SASI_Mm01_00196688 predicted 710
13 SASI_Mm01_00196693 predicted 646
14 SASI_Mm01_00196694 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018326
GIMAP4 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018326.2-1225s21c1
Sequence:CCGGTAACAAGAGAGGGACAAATTTCTCGAGAAATTTGTCCCTCTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018326.2-330s21c1
Sequence:CCGGTAGTTGACACACCAGGCATTTCTCGAGAAATGCCTGGTGTGTCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-479s1c1
Sequence:CCGGGCCACAGAGAAGATCCTGAAACTCGAGTTTCAGGATCTTCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-1007s1c1
Sequence:CCGGGAATTAATCATGACAGCGTTACTCGAGTAACGCTGTCATGATTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-374s1c1
Sequence:CCGGGAAACGTCCAAGGAGATTATTCTCGAGAATAATCTCCTTGGACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-634s1c1
Sequence:CCGGCCGCTACTGTGCGTTAAACAACTCGAGTTGTTTAACGCACAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-842s1c1
Sequence:CCGGCGGATAAGAGAGGAGTATGAACTCGAGTTCATACTCCTCTCTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018326
GIMAP4 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018326.2-1225s21c1
Sequence:CCGGTAACAAGAGAGGGACAAATTTCTCGAGAAATTTGTCCCTCTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018326.2-330s21c1
Sequence:CCGGTAGTTGACACACCAGGCATTTCTCGAGAAATGCCTGGTGTGTCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-479s1c1
Sequence:CCGGGCCACAGAGAAGATCCTGAAACTCGAGTTTCAGGATCTTCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-1007s1c1
Sequence:CCGGGAATTAATCATGACAGCGTTACTCGAGTAACGCTGTCATGATTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-374s1c1
Sequence:CCGGGAAACGTCCAAGGAGATTATTCTCGAGAATAATCTCCTTGGACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-634s1c1
Sequence:CCGGCCGCTACTGTGCGTTAAACAACTCGAGTTGTTTAACGCACAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-842s1c1
Sequence:CCGGCGGATAAGAGAGGAGTATGAACTCGAGTTCATACTCCTCTCTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018326
GIMAP4 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018326.2-1225s21c1
Sequence:CCGGTAACAAGAGAGGGACAAATTTCTCGAGAAATTTGTCCCTCTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018326.2-330s21c1
Sequence:CCGGTAGTTGACACACCAGGCATTTCTCGAGAAATGCCTGGTGTGTCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-479s1c1
Sequence:CCGGGCCACAGAGAAGATCCTGAAACTCGAGTTTCAGGATCTTCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-1007s1c1
Sequence:CCGGGAATTAATCATGACAGCGTTACTCGAGTAACGCTGTCATGATTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-374s1c1
Sequence:CCGGGAAACGTCCAAGGAGATTATTCTCGAGAATAATCTCCTTGGACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-634s1c1
Sequence:CCGGCCGCTACTGTGCGTTAAACAACTCGAGTTGTTTAACGCACAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018326.2-842s1c1
Sequence:CCGGCGGATAAGAGAGGAGTATGAACTCGAGTTCATACTCCTCTCTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174990
GIMAP4 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174990.3-1380s1c1
Sequence:CCGGCCACACATGATACCCATATTTCTCGAGAAATATGGGTATCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-770s1c1
Sequence:CCGGCCTTGAGGATGCAAGAATTATCTCGAGATAATTCTTGCATCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-964s1c1
Sequence:CCGGGAGAACACAAGTATGATACTTCTCGAGAAGTATCATACTTGTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-358s1c1
Sequence:CCGGCAAAGGGAGATCACTCGCTATCTCGAGATAGCGAGTGATCTCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-1016s1c1
Sequence:CCGGCCTTTATCTTCAACCAGTTTACTCGAGTAAACTGGTTGAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174990
GIMAP4 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174990.3-1380s1c1
Sequence:CCGGCCACACATGATACCCATATTTCTCGAGAAATATGGGTATCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-770s1c1
Sequence:CCGGCCTTGAGGATGCAAGAATTATCTCGAGATAATTCTTGCATCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-964s1c1
Sequence:CCGGGAGAACACAAGTATGATACTTCTCGAGAAGTATCATACTTGTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-358s1c1
Sequence:CCGGCAAAGGGAGATCACTCGCTATCTCGAGATAGCGAGTGATCTCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-1016s1c1
Sequence:CCGGCCTTTATCTTCAACCAGTTTACTCGAGTAAACTGGTTGAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174990
GIMAP4 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174990.3-1380s1c1
Sequence:CCGGCCACACATGATACCCATATTTCTCGAGAAATATGGGTATCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-770s1c1
Sequence:CCGGCCTTGAGGATGCAAGAATTATCTCGAGATAATTCTTGCATCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-964s1c1
Sequence:CCGGGAGAACACAAGTATGATACTTCTCGAGAAGTATCATACTTGTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-358s1c1
Sequence:CCGGCAAAGGGAGATCACTCGCTATCTCGAGATAGCGAGTGATCTCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174990.3-1016s1c1
Sequence:CCGGCCTTTATCTTCAACCAGTTTACTCGAGTAAACTGGTTGAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks