EMAIL THIS PAGE TO A FRIEND

GIMAP5

GTPase, IMAP family member 5

65 Gene Product Result for
Synonyms: HIMAP3 IAN-5 IAN4 IAN4L1 IAN5 IMAP3 IROD
UniProtKB ID: Q96F15, D3DWZ5, Q6IA75, Q96NE4, Q9NUK9
Gene ID:
Human(55340) Summary: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. This gene encodes an antiapoptotic protein that functions in T-cell survival. Polymorphisms in this gene are associated with systemic lupus erythematosus. Read-through transcription exists between this gene and the neighboring upstream GIMAP1 (GTPase, IMAP family member 1) gene. [provided by RefSeq, Dec 2010]
Mouse(317757) GTPase, IMAP family member 5
Rat(246774) GTPase, IMAP family member 5
chicken(420413) GTPase, IMAP family member 5
cow(505013) GTPase, IMAP family member 5
domestic cat(101081130) GTPase, IMAP family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018384 Rosetta Predictions human pricing
NM_001033913 Rosetta Predictions rat pricing
NM_145680 Rosetta Predictions rat pricing
NM_175035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351867 predicted 386
2 SASI_Hs01_00168910 predicted 714
3 SASI_Hs02_00351868 predicted 496
4 SASI_Hs02_00351869 predicted 433
5 SASI_Hs02_00351870 predicted 375
6 SASI_Hs01_00168916 predicted 423
7 SASI_Hs01_00168918 predicted 571
8 SASI_Hs02_00351871 predicted 402
9 SASI_Hs02_00351872 predicted 888
10 SASI_Hs02_00351873 predicted 746
11 SASI_Hs01_00168911 predicted 626
12 SASI_Hs01_00168912 predicted 1250
13 SASI_Hs01_00168913 predicted 574
14 SASI_Hs01_00168914 predicted 623
15 SASI_Hs01_00168915 predicted 1165
16 SASI_Hs01_00168917 predicted 1076
17 SASI_Hs01_00168919 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067000 predicted 967
2 SASI_Rn01_00067001 predicted 1144
3 SASI_Rn01_00067003 predicted 1265
4 SASI_Rn01_00067004 predicted 1123
5 SASI_Rn01_00067005 predicted 941
6 SASI_Rn02_00203823 predicted 849
7 SASI_Rn01_00067006 predicted 888
8 SASI_Rn01_00067007 predicted 1248
9 SASI_Rn01_00067008 predicted 772
10 SASI_Rn01_00067009 predicted 778
11 SASI_Rn01_00067002 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081135 predicted 784
2 SASI_Rn01_00081136 predicted 966
3 SASI_Rn01_00081138 predicted 1092
4 SASI_Rn01_00081139 predicted 949
5 SASI_Rn01_00081140 predicted 763
6 SASI_Rn02_00268734 predicted 678
7 SASI_Rn01_00081141 predicted 716
8 SASI_Rn01_00081142 predicted 1079
9 SASI_Rn01_00081143 predicted 596
10 SASI_Rn01_00081144 predicted 601
11 SASI_Rn01_00081137 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048783 predicted 1375
2 SASI_Mm01_00048784 predicted 255
3 SASI_Mm01_00048785 predicted 1122
4 SASI_Mm01_00048786 predicted 1234
5 SASI_Mm01_00048787 predicted 1373
6 SASI_Mm01_00048788 predicted 1253
7 SASI_Mm01_00048789 predicted 1214
8 SASI_Mm01_00048790 predicted 303
9 SASI_Mm01_00048791 predicted 1366
10 SASI_Mm01_00048792 predicted 1133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018384
GIMAP5 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-388s1c1
Sequence:CCGGAGGATTATCCTAGTGGGCAAACTCGAGTTTGCCCACTAGGATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-1119s1c1
Sequence:CCGGCCTCAGAGTCAAACACTTGATCTCGAGATCAAGTGTTTGACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-782s1c1
Sequence:CCGGCCCTGGATGACTATGTAGCAACTCGAGTTGCTACATAGTCATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-341s1c1
Sequence:CCGGCTGAAGGTAGATCAGAAGATACTCGAGTATCTTCTGATCTACCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-1092s1c1
Sequence:CCGGCGAGAGTAACTGGGCATACAACTCGAGTTGTATGCCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018384.3-1283s21c1
Sequence:CCGGGGACCCTGGAGCACTTCTAATCTCGAGATTAGAAGTGCTCCAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018384.3-792s21c1
Sequence:CCGGTCATCCTCTTCACCCACAAAGCTCGAGCTTTGTGGGTGAAGAGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018384
GIMAP5 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-388s1c1
Sequence:CCGGAGGATTATCCTAGTGGGCAAACTCGAGTTTGCCCACTAGGATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-1119s1c1
Sequence:CCGGCCTCAGAGTCAAACACTTGATCTCGAGATCAAGTGTTTGACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-782s1c1
Sequence:CCGGCCCTGGATGACTATGTAGCAACTCGAGTTGCTACATAGTCATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-341s1c1
Sequence:CCGGCTGAAGGTAGATCAGAAGATACTCGAGTATCTTCTGATCTACCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-1092s1c1
Sequence:CCGGCGAGAGTAACTGGGCATACAACTCGAGTTGTATGCCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018384.3-1283s21c1
Sequence:CCGGGGACCCTGGAGCACTTCTAATCTCGAGATTAGAAGTGCTCCAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018384.3-792s21c1
Sequence:CCGGTCATCCTCTTCACCCACAAAGCTCGAGCTTTGTGGGTGAAGAGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018384
GIMAP5 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-388s1c1
Sequence:CCGGAGGATTATCCTAGTGGGCAAACTCGAGTTTGCCCACTAGGATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-1119s1c1
Sequence:CCGGCCTCAGAGTCAAACACTTGATCTCGAGATCAAGTGTTTGACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-782s1c1
Sequence:CCGGCCCTGGATGACTATGTAGCAACTCGAGTTGCTACATAGTCATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-341s1c1
Sequence:CCGGCTGAAGGTAGATCAGAAGATACTCGAGTATCTTCTGATCTACCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018384.2-1092s1c1
Sequence:CCGGCGAGAGTAACTGGGCATACAACTCGAGTTGTATGCCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018384.3-1283s21c1
Sequence:CCGGGGACCCTGGAGCACTTCTAATCTCGAGATTAGAAGTGCTCCAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018384.3-792s21c1
Sequence:CCGGTCATCCTCTTCACCCACAAAGCTCGAGCTTTGTGGGTGAAGAGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175035
GIMAP5 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175035.4-1518s1c1
Sequence:CCGGGCAGAGTCATACTTTAGTCAACTCGAGTTGACTAAAGTATGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1143s1c1
Sequence:CCGGCTTGTGTATTAGCAGGTGTAACTCGAGTTACACCTGCTAATACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-293s1c1
Sequence:CCGGCCCACTGTGTACAAGAATCTACTCGAGTAGATTCTTGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1115s1c1
Sequence:CCGGGTTTGACTCTTCTCACCACTTCTCGAGAAGTGGTGAGAAGAGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1130s1c1
Sequence:CCGGCCACTTTCATTAACTTGTGTACTCGAGTACACAAGTTAATGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175035
GIMAP5 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175035.4-1518s1c1
Sequence:CCGGGCAGAGTCATACTTTAGTCAACTCGAGTTGACTAAAGTATGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1143s1c1
Sequence:CCGGCTTGTGTATTAGCAGGTGTAACTCGAGTTACACCTGCTAATACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-293s1c1
Sequence:CCGGCCCACTGTGTACAAGAATCTACTCGAGTAGATTCTTGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1115s1c1
Sequence:CCGGGTTTGACTCTTCTCACCACTTCTCGAGAAGTGGTGAGAAGAGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1130s1c1
Sequence:CCGGCCACTTTCATTAACTTGTGTACTCGAGTACACAAGTTAATGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175035
GIMAP5 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175035.4-1518s1c1
Sequence:CCGGGCAGAGTCATACTTTAGTCAACTCGAGTTGACTAAAGTATGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1143s1c1
Sequence:CCGGCTTGTGTATTAGCAGGTGTAACTCGAGTTACACCTGCTAATACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-293s1c1
Sequence:CCGGCCCACTGTGTACAAGAATCTACTCGAGTAGATTCTTGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1115s1c1
Sequence:CCGGGTTTGACTCTTCTCACCACTTCTCGAGAAGTGGTGAGAAGAGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175035.4-1130s1c1
Sequence:CCGGCCACTTTCATTAACTTGTGTACTCGAGTACACAAGTTAATGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks