EMAIL THIS PAGE TO A FRIEND

GIMAP6

GTPase, IMAP family member 6

130 Gene Product Result for
Synonyms: IAN-2 IAN-6 IAN2 IAN6
UniProtKB ID: Q6P9H5, C9J7B6, D3DWZ4, Q5ZPR6, Q9H612
Gene ID:
Human(474344) Summary: This gene encodes a member of the GTPases of immunity-associated proteins (GIMAP) family. GIMAP proteins contain GTP-binding and coiled-coil motifs, and may play roles in the regulation of cell survival. Decreased expression of this gene may play a role in non-small cell lung cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is found in a cluster with seven additional GIMAP genes on the long arm of chromosome 7. [provided by RefSeq, Sep 2011]
Mouse(231931) GTPase, IMAP family member 6
Rat(297076) GTPase, IMAP family member 6
cow(528288) GTPase, IMAP family member 6
domestic cat(101100552) GTPase, IMAP family member 6
dog(482796) GTPase, IMAP family member 6
sheep(101110230) GTPase, IMAP family member 6
domestic guinea pig(101789265) GTPase, IMAP family member 6
naked mole-rat(101724147) GTPase, IMAP family member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024711 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007224 Rosetta Predictions human pricing
NM_024711 Rosetta Predictions human pricing
NM_001011968 Rosetta Predictions rat pricing
XM_575464 Rosetta Predictions rat pricing
NM_153175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223743 predicted 635
2 SASI_Hs01_00223744 predicted 650
3 SASI_Hs01_00223746 predicted 481
4 SASI_Hs01_00223747 predicted 1107
5 SASI_Hs02_00305250 predicted 1075
6 SASI_Hs01_00223748 predicted 854
7 SASI_Hs01_00223750 predicted 710
8 SASI_Hs01_00223751 predicted 1078
9 SASI_Hs02_00305251 predicted 1019
10 SASI_Hs02_00305252 predicted 1243
11 SASI_Hs01_00223745 predicted 688
12 SASI_Hs01_00223749 predicted 990
13 SASI_Hs01_00223752 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131948 predicted 867
2 SASI_Hs01_00131949 predicted 878
3 SASI_Hs01_00131951 predicted 704
4 SASI_Hs01_00131952 predicted 1331
5 SASI_Hs02_00357168 predicted 1295
6 SASI_Hs01_00131953 predicted 1082
7 SASI_Hs01_00131955 predicted 937
8 SASI_Hs01_00131956 predicted 1303
9 SASI_Hs02_00357169 predicted 1246
10 SASI_Hs02_00357170 predicted 1461
11 SASI_Hs01_00131950 predicted 914
12 SASI_Hs01_00131954 predicted 1212
13 SASI_Hs01_00131957 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105317 predicted 916
2 SASI_Rn01_00105318 predicted 667
3 SASI_Rn01_00105319 predicted 800
4 SASI_Rn02_00199987 predicted 974
5 SASI_Rn02_00199988 predicted 1021
6 SASI_Rn01_00105320 predicted 1056
7 SASI_Rn02_00199989 predicted 314
8 SASI_Rn01_00105324 predicted 336
9 SASI_Rn01_00105325 predicted 1091
10 SASI_Rn01_00105326 predicted 1093
11 SASI_Rn01_00105321 predicted 762
12 SASI_Rn01_00105322 predicted 1055
13 SASI_Rn01_00105323 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144336 predicted 432
2 SASI_Rn01_00144337 predicted 444
3 SASI_Rn01_00144338 predicted 468
4 SASI_Rn01_00144339 predicted 319
5 SASI_Rn01_00144340 predicted 472
6 SASI_Rn01_00144341 predicted 465
7 SASI_Rn01_00144342 predicted 221
8 SASI_Rn01_00144343 predicted 253
9 SASI_Rn01_00144344 predicted 310
10 SASI_Rn01_00144345 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194639 predicted 727
2 SASI_Mm01_00194640 predicted 957
3 SASI_Mm01_00194641 predicted 1135
4 SASI_Mm01_00194642 predicted 743
5 SASI_Mm01_00194643 predicted 931
6 SASI_Mm01_00194645 predicted 969
7 SASI_Mm01_00194646 predicted 1270
8 SASI_Mm01_00194647 predicted 1000
9 SASI_Mm01_00194648 predicted 1256
10 SASI_Mm02_00343100 predicted 826
11 SASI_Mm01_00194644 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153175
GIMAP6 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153175.3-1237s1c1
Sequence:CCGGGCCCATTATCTGGACTATTTACTCGAGTAAATAGTCCAGATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-132s1c1
Sequence:CCGGGCTCATGTTCTATAGAAACTTCTCGAGAAGTTTCTATAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-349s1c1
Sequence:CCGGCTCTGGACAAGGATTGACAAACTCGAGTTTGTCAATCCTTGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-788s1c1
Sequence:CCGGGAGGGCTCCTTAGAAGAATATCTCGAGATATTCTTCTAAGGAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-964s1c1
Sequence:CCGGCCATTGTTACACCATGGAATTCTCGAGAATTCCATGGTGTAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153175
GIMAP6 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153175.3-1237s1c1
Sequence:CCGGGCCCATTATCTGGACTATTTACTCGAGTAAATAGTCCAGATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-132s1c1
Sequence:CCGGGCTCATGTTCTATAGAAACTTCTCGAGAAGTTTCTATAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-349s1c1
Sequence:CCGGCTCTGGACAAGGATTGACAAACTCGAGTTTGTCAATCCTTGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-788s1c1
Sequence:CCGGGAGGGCTCCTTAGAAGAATATCTCGAGATATTCTTCTAAGGAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-964s1c1
Sequence:CCGGCCATTGTTACACCATGGAATTCTCGAGAATTCCATGGTGTAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153175
GIMAP6 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153175.3-1237s1c1
Sequence:CCGGGCCCATTATCTGGACTATTTACTCGAGTAAATAGTCCAGATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-132s1c1
Sequence:CCGGGCTCATGTTCTATAGAAACTTCTCGAGAAGTTTCTATAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-349s1c1
Sequence:CCGGCTCTGGACAAGGATTGACAAACTCGAGTTTGTCAATCCTTGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-788s1c1
Sequence:CCGGGAGGGCTCCTTAGAAGAATATCTCGAGATATTCTTCTAAGGAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153175.3-964s1c1
Sequence:CCGGCCATTGTTACACCATGGAATTCTCGAGAATTCCATGGTGTAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024711
GIMAP6 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-822s1c1
Sequence:CCGGCGAGAGCTCATGGAGAAAGTTCTCGAGAACTTTCTCCATGAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-344s1c1
Sequence:CCGGGAGTGCAACAGGAAACAGCATCTCGAGATGCTGTTTCCTGTTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-384s1c1
Sequence:CCGGGAGTCTAAACTCAGCACCAGACTCGAGTCTGGTGCTGAGTTTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-878s1c1
Sequence:CCGGCAGCAACAAGGCTTACCAATACTCGAGTATTGGTAAGCCTTGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-863s1c1
Sequence:CCGGCGAAGGAGATTATTACAGCAACTCGAGTTGCTGTAATAATCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024711.3-3010s1c1
Sequence:CCGGCCTTGTTATTCTCAGGCATTTCTCGAGAAATGCCTGAGAATAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-924s1c1
Sequence:CCGGGAACTACAGGAAAGGCAAGTACTCGAGTACTTGCCTTTCCTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024711.3-1858s1c1
Sequence:CCGGCCACCAAGGTAGACTTAGATTCTCGAGAATCTAAGTCTACCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024711
GIMAP6 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-822s1c1
Sequence:CCGGCGAGAGCTCATGGAGAAAGTTCTCGAGAACTTTCTCCATGAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-344s1c1
Sequence:CCGGGAGTGCAACAGGAAACAGCATCTCGAGATGCTGTTTCCTGTTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-384s1c1
Sequence:CCGGGAGTCTAAACTCAGCACCAGACTCGAGTCTGGTGCTGAGTTTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-878s1c1
Sequence:CCGGCAGCAACAAGGCTTACCAATACTCGAGTATTGGTAAGCCTTGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-863s1c1
Sequence:CCGGCGAAGGAGATTATTACAGCAACTCGAGTTGCTGTAATAATCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024711.3-3010s1c1
Sequence:CCGGCCTTGTTATTCTCAGGCATTTCTCGAGAAATGCCTGAGAATAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-924s1c1
Sequence:CCGGGAACTACAGGAAAGGCAAGTACTCGAGTACTTGCCTTTCCTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024711.3-1858s1c1
Sequence:CCGGCCACCAAGGTAGACTTAGATTCTCGAGAATCTAAGTCTACCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024711
GIMAP6 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-822s1c1
Sequence:CCGGCGAGAGCTCATGGAGAAAGTTCTCGAGAACTTTCTCCATGAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-344s1c1
Sequence:CCGGGAGTGCAACAGGAAACAGCATCTCGAGATGCTGTTTCCTGTTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-384s1c1
Sequence:CCGGGAGTCTAAACTCAGCACCAGACTCGAGTCTGGTGCTGAGTTTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-878s1c1
Sequence:CCGGCAGCAACAAGGCTTACCAATACTCGAGTATTGGTAAGCCTTGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024711.3-863s1c1
Sequence:CCGGCGAAGGAGATTATTACAGCAACTCGAGTTGCTGTAATAATCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024711.3-3010s1c1
Sequence:CCGGCCTTGTTATTCTCAGGCATTTCTCGAGAAATGCCTGAGAATAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024711.3-924s1c1
Sequence:CCGGGAACTACAGGAAAGGCAAGTACTCGAGTACTTGCCTTTCCTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024711.3-1858s1c1
Sequence:CCGGCCACCAAGGTAGACTTAGATTCTCGAGAATCTAAGTCTACCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks