EMAIL THIS PAGE TO A FRIEND

GIMAP7

GTPase, IMAP family member 7

51 Gene Product Result for
Synonyms: IAN7 hIAN7
UniProtKB ID: Q8NHV1
Gene ID:
Human(168537) Summary: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Mouse(231932) GTPase, IMAP family member 7
Rat(500113) GTPase, IMAP family member 7
naked mole-rat(101728081) GTPase, IMAP family member 7
domestic guinea pig(100732570) GTPase, IMAP family member 7
Zebrafish(553227) GIMAP7 protein
dog(610898) GTPase, IMAP family member 7
cow(530031) GTPase, IMAP family member 7
cow(100125415) GTPase, IMAP family member 7
cow(614871) GTPase, IMAP family member 7
cow(510988) GTPase, IMAP family member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153236 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153236 Rosetta Predictions human pricing
NM_001024328 Rosetta Predictions rat pricing
NM_146167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206961 predicted 251
2 SASI_Hs01_00206962 predicted 497
3 SASI_Hs01_00206963 predicted 292
4 SASI_Hs02_00367102 predicted 545
5 SASI_Hs01_00206964 predicted 220
6 SASI_Hs01_00206965 predicted 507
7 SASI_Hs01_00206966 predicted 507
8 SASI_Hs01_00206967 predicted 345
9 SASI_Hs01_00206968 predicted 294
10 SASI_Hs01_00206969 predicted 497
11 SASI_Hs01_00206970 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109740 predicted 382
2 SASI_Rn01_00109741 predicted 520
3 SASI_Rn01_00109742 predicted 381
4 SASI_Rn01_00109743 predicted 230
5 SASI_Rn01_00109744 predicted 274
6 SASI_Rn02_00202546 predicted 679
7 SASI_Rn02_00202547 predicted 522
8 SASI_Rn01_00109746 predicted 696
9 SASI_Rn01_00109748 predicted 303
10 SASI_Rn02_00202548 predicted 339
11 SASI_Rn01_00109745 predicted 600
12 SASI_Rn01_00109747 predicted 551
13 SASI_Rn01_00109749 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175465 predicted 304
2 SASI_Mm02_00341861 predicted 929
3 SASI_Mm01_00175467 predicted 382
4 SASI_Mm01_00175468 predicted 608
5 SASI_Mm01_00175469 predicted 234
6 SASI_Mm01_00175470 predicted 777
7 SASI_Mm02_00341862 predicted 524
8 SASI_Mm01_00175471 predicted 275
9 SASI_Mm01_00175472 predicted 775
10 SASI_Mm01_00175473 predicted 336
11 SASI_Mm01_00175466 predicted 555
12 SASI_Mm01_00175474 predicted 926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153236
GIMAP7 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-449s1c1
Sequence:CCGGGCATTGATCAAGGCTGTCTTTCTCGAGAAAGACAGCCTTGATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-965s1c1
Sequence:CCGGTCAGAAATATGGCATAGGTTTCTCGAGAAACCTATGCCATATTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-815s1c1
Sequence:CCGGGTAGAAGAGGATAAGCATAAACTCGAGTTTATGCTTATCCTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-140s1c1
Sequence:CCGGAGGATCGTTCTGGTAGGGAAACTCGAGTTTCCCTACCAGAACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-494s1c1
Sequence:CCGGGTCATCTTGTTCACTCGCAAACTCGAGTTTGCGAGTGAACAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-315s21c1
Sequence:CCGGTAGACACTCCAGGGCTCTTTGCTCGAGCAAAGAGCCCTGGAGTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153236.3-1042s21c1
Sequence:CCGGGATTTGTTAATGGATGAATTGCTCGAGCAATTCATCCATTAACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153236.3-1068s21c1
Sequence:CCGGTGCAAAGATAGTTAGAGAAATCTCGAGATTTCTCTAACTATCTTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-405s21c1
Sequence:CCGGCCCATGCTATTGTCCTAGTTCCTCGAGGAACTAGGACAATAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-563s21c1
Sequence:CCGGTTCATAGCAGATGCGGATGTGCTCGAGCACATCCGCATCTGCTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153236
GIMAP7 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-449s1c1
Sequence:CCGGGCATTGATCAAGGCTGTCTTTCTCGAGAAAGACAGCCTTGATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-965s1c1
Sequence:CCGGTCAGAAATATGGCATAGGTTTCTCGAGAAACCTATGCCATATTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-815s1c1
Sequence:CCGGGTAGAAGAGGATAAGCATAAACTCGAGTTTATGCTTATCCTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-140s1c1
Sequence:CCGGAGGATCGTTCTGGTAGGGAAACTCGAGTTTCCCTACCAGAACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-494s1c1
Sequence:CCGGGTCATCTTGTTCACTCGCAAACTCGAGTTTGCGAGTGAACAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-315s21c1
Sequence:CCGGTAGACACTCCAGGGCTCTTTGCTCGAGCAAAGAGCCCTGGAGTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153236.3-1042s21c1
Sequence:CCGGGATTTGTTAATGGATGAATTGCTCGAGCAATTCATCCATTAACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153236.3-1068s21c1
Sequence:CCGGTGCAAAGATAGTTAGAGAAATCTCGAGATTTCTCTAACTATCTTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-405s21c1
Sequence:CCGGCCCATGCTATTGTCCTAGTTCCTCGAGGAACTAGGACAATAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-563s21c1
Sequence:CCGGTTCATAGCAGATGCGGATGTGCTCGAGCACATCCGCATCTGCTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153236
GIMAP7 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-449s1c1
Sequence:CCGGGCATTGATCAAGGCTGTCTTTCTCGAGAAAGACAGCCTTGATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-965s1c1
Sequence:CCGGTCAGAAATATGGCATAGGTTTCTCGAGAAACCTATGCCATATTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-815s1c1
Sequence:CCGGGTAGAAGAGGATAAGCATAAACTCGAGTTTATGCTTATCCTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-140s1c1
Sequence:CCGGAGGATCGTTCTGGTAGGGAAACTCGAGTTTCCCTACCAGAACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153236.2-494s1c1
Sequence:CCGGGTCATCTTGTTCACTCGCAAACTCGAGTTTGCGAGTGAACAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-315s21c1
Sequence:CCGGTAGACACTCCAGGGCTCTTTGCTCGAGCAAAGAGCCCTGGAGTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153236.3-1042s21c1
Sequence:CCGGGATTTGTTAATGGATGAATTGCTCGAGCAATTCATCCATTAACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153236.3-1068s21c1
Sequence:CCGGTGCAAAGATAGTTAGAGAAATCTCGAGATTTCTCTAACTATCTTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-405s21c1
Sequence:CCGGCCCATGCTATTGTCCTAGTTCCTCGAGGAACTAGGACAATAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153236.3-563s21c1
Sequence:CCGGTTCATAGCAGATGCGGATGTGCTCGAGCACATCCGCATCTGCTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146167
GIMAP7 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-142s1c1
Sequence:CCGGAGGATTGTTCTGGTAGGGAAACTCGAGTTTCCCTACCAGAACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-687s1c1
Sequence:CCGGGCAGAACAATGGTGGTCTCTACTCGAGTAGAGACCACCATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-531s1c1
Sequence:CCGGCCAGAGCTTAAGCGACTTCATCTCGAGATGAAGTCGCTTAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-312s1c1
Sequence:CCGGGCTCTTCGACACCAAGGTAAACTCGAGTTTACCTTGGTGTCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146167.3-1084s1c1
Sequence:CCGGGCAGATTTAAGAGATAGCAAACTCGAGTTTGCTATCTCTTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146167
GIMAP7 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-142s1c1
Sequence:CCGGAGGATTGTTCTGGTAGGGAAACTCGAGTTTCCCTACCAGAACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-687s1c1
Sequence:CCGGGCAGAACAATGGTGGTCTCTACTCGAGTAGAGACCACCATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-531s1c1
Sequence:CCGGCCAGAGCTTAAGCGACTTCATCTCGAGATGAAGTCGCTTAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-312s1c1
Sequence:CCGGGCTCTTCGACACCAAGGTAAACTCGAGTTTACCTTGGTGTCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146167.3-1084s1c1
Sequence:CCGGGCAGATTTAAGAGATAGCAAACTCGAGTTTGCTATCTCTTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146167
GIMAP7 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-142s1c1
Sequence:CCGGAGGATTGTTCTGGTAGGGAAACTCGAGTTTCCCTACCAGAACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-687s1c1
Sequence:CCGGGCAGAACAATGGTGGTCTCTACTCGAGTAGAGACCACCATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-531s1c1
Sequence:CCGGCCAGAGCTTAAGCGACTTCATCTCGAGATGAAGTCGCTTAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146167.3-312s1c1
Sequence:CCGGGCTCTTCGACACCAAGGTAAACTCGAGTTTACCTTGGTGTCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146167.3-1084s1c1
Sequence:CCGGGCAGATTTAAGAGATAGCAAACTCGAGTTTGCTATCTCTTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks