EMAIL THIS PAGE TO A FRIEND

GIMAP8

GTPase, IMAP family member 8

Synonyms: IAN-9 IAN6 IANT hIAN6
UniProtKB ID: Q8ND71
Gene ID:
Human(155038) Summary: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Mouse(243374) GTPase, IMAP family member 8
Rat(500112) GTPase, IMAP family member 8
chicken(420364) GTPase, IMAP family member 8
cow(531516) GTPase, IMAP family member 8
domestic cat(101093845) GTPase, IMAP family member 8
Horse(100063176) GTPase, IMAP family member 8
dog(482794) GTPase, IMAP family member 8
Domestic Rabbit(100343010) GTPase, IMAP family member 8
naked mole-rat(101724849) GTPase, IMAP family member 8
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175571 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_212486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033201 MISSION® esiRNA esiRNA human GIMAP8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175571 Rosetta Predictions human pricing
NM_001033923 Rosetta Predictions rat pricing
NM_001077410 Rosetta Predictions mouse pricing
NM_212486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217143 predicted 1149
2 SASI_Hs01_00217144 predicted 2265
3 SASI_Hs01_00217145 predicted 1508
4 SASI_Hs01_00217149 predicted 1969
5 SASI_Hs02_00368997 predicted 1441
6 SASI_Hs01_00217150 predicted 1988
7 SASI_Hs01_00217151 predicted 549
8 SASI_Hs01_00217152 predicted 969
9 SASI_Hs02_00368998 predicted 492
10 SASI_Hs02_00368999 predicted 703
11 SASI_Hs01_00217146 predicted 1999
12 SASI_Hs01_00217147 predicted 1486
13 SASI_Hs01_00217148 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038898 predicted 2143
2 SASI_Rn01_00038899 predicted 1832
3 SASI_Rn01_00038900 predicted 2103
4 SASI_Rn02_00203825 predicted 1755
5 SASI_Rn01_00038901 predicted 1943
6 SASI_Rn01_00038902 predicted 349
7 SASI_Rn02_00203826 predicted 1565
8 SASI_Rn01_00038903 predicted 2197
9 SASI_Rn01_00038905 predicted 1170
10 SASI_Rn01_00038906 predicted 2009
11 SASI_Rn01_00038897 predicted 814
12 SASI_Rn01_00038904 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292632 predicted 997
2 SASI_Mm02_00292633 predicted 557
3 SASI_Mm02_00292634 predicted 1252
4 SASI_Mm02_00292635 predicted 1074
5 SASI_Mm02_00292636 predicted 1365
6 SASI_Mm02_00292637 predicted 565
7 SASI_Mm02_00292638 predicted 1339
8 SASI_Mm02_00292639 predicted 276
9 SASI_Mm02_00292640 predicted 1741
10 SASI_Mm02_00292641 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138460 predicted 996
2 SASI_Mm01_00138461 predicted 552
3 SASI_Mm01_00138462 predicted 1253
4 SASI_Mm02_00352286 predicted 1073
5 SASI_Mm01_00138463 predicted 1363
6 SASI_Mm01_00138464 predicted 565
7 SASI_Mm01_00138466 predicted 1328
8 SASI_Mm01_00138467 predicted 270
9 SASI_Mm01_00138468 predicted 1734
10 SASI_Mm01_00138469 predicted 681
11 SASI_Mm01_00138465 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175571
GIMAP8 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175571.2-812s21c1
Sequence:CCGGATGAGGGCCGATACTGCATTTCTCGAGAAATGCAGTATCGGCCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175571.2-627s21c1
Sequence:CCGGGGTAATTGCCATCGGCCATTTCTCGAGAAATGGCCGATGGCAATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-763s1c1
Sequence:CCGGCCCTATCATGTGAACTTCAAACTCGAGTTTGAAGTTCACATGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-1817s1c1
Sequence:CCGGCCATCTTTGGAGCAGACTTTACTCGAGTAAAGTCTGCTCCAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-2024s1c1
Sequence:CCGGCAAAGGTCAATGATCTGAGAACTCGAGTTCTCAGATCATTGACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-625s1c1
Sequence:CCGGCCTCTCAAGCAGTTGGTTCAACTCGAGTTGAACCAACTGCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-1075s1c1
Sequence:CCGGGCTCCGGACATCTCATCTTTACTCGAGTAAAGATGAGATGTCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175571
GIMAP8 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175571.2-812s21c1
Sequence:CCGGATGAGGGCCGATACTGCATTTCTCGAGAAATGCAGTATCGGCCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175571.2-627s21c1
Sequence:CCGGGGTAATTGCCATCGGCCATTTCTCGAGAAATGGCCGATGGCAATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-763s1c1
Sequence:CCGGCCCTATCATGTGAACTTCAAACTCGAGTTTGAAGTTCACATGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-1817s1c1
Sequence:CCGGCCATCTTTGGAGCAGACTTTACTCGAGTAAAGTCTGCTCCAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-2024s1c1
Sequence:CCGGCAAAGGTCAATGATCTGAGAACTCGAGTTCTCAGATCATTGACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-625s1c1
Sequence:CCGGCCTCTCAAGCAGTTGGTTCAACTCGAGTTGAACCAACTGCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-1075s1c1
Sequence:CCGGGCTCCGGACATCTCATCTTTACTCGAGTAAAGATGAGATGTCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175571
GIMAP8 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175571.2-812s21c1
Sequence:CCGGATGAGGGCCGATACTGCATTTCTCGAGAAATGCAGTATCGGCCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175571.2-627s21c1
Sequence:CCGGGGTAATTGCCATCGGCCATTTCTCGAGAAATGGCCGATGGCAATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-763s1c1
Sequence:CCGGCCCTATCATGTGAACTTCAAACTCGAGTTTGAAGTTCACATGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-1817s1c1
Sequence:CCGGCCATCTTTGGAGCAGACTTTACTCGAGTAAAGTCTGCTCCAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-2024s1c1
Sequence:CCGGCAAAGGTCAATGATCTGAGAACTCGAGTTCTCAGATCATTGACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-625s1c1
Sequence:CCGGCCTCTCAAGCAGTTGGTTCAACTCGAGTTGAACCAACTGCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175571.1-1075s1c1
Sequence:CCGGGCTCCGGACATCTCATCTTTACTCGAGTAAAGATGAGATGTCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212486
GIMAP8 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212486.2-2910s1c1
Sequence:CCGGCCTCCATAGTAGATAAGCTAACTCGAGTTAGCTTATCTACTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-996s1c1
Sequence:CCGGGCAGGTCTTTAAGACTCAGTTCTCGAGAACTGAGTCTTAAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-1474s1c1
Sequence:CCGGCCTTGCGTCATCAGAGAGAAACTCGAGTTTCTCTCTGATGACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-2117s1c1
Sequence:CCGGGCCAAATTACTATGGCATTTACTCGAGTAAATGCCATAGTAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-1132s1c1
Sequence:CCGGGCTGTCAAGAATCACACCTTTCTCGAGAAAGGTGTGATTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212486
GIMAP8 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212486.2-2910s1c1
Sequence:CCGGCCTCCATAGTAGATAAGCTAACTCGAGTTAGCTTATCTACTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-996s1c1
Sequence:CCGGGCAGGTCTTTAAGACTCAGTTCTCGAGAACTGAGTCTTAAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-1474s1c1
Sequence:CCGGCCTTGCGTCATCAGAGAGAAACTCGAGTTTCTCTCTGATGACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-2117s1c1
Sequence:CCGGGCCAAATTACTATGGCATTTACTCGAGTAAATGCCATAGTAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-1132s1c1
Sequence:CCGGGCTGTCAAGAATCACACCTTTCTCGAGAAAGGTGTGATTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212486
GIMAP8 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212486.2-2910s1c1
Sequence:CCGGCCTCCATAGTAGATAAGCTAACTCGAGTTAGCTTATCTACTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-996s1c1
Sequence:CCGGGCAGGTCTTTAAGACTCAGTTCTCGAGAACTGAGTCTTAAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-1474s1c1
Sequence:CCGGCCTTGCGTCATCAGAGAGAAACTCGAGTTTCTCTCTGATGACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-2117s1c1
Sequence:CCGGGCCAAATTACTATGGCATTTACTCGAGTAAATGCCATAGTAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212486.2-1132s1c1
Sequence:CCGGGCTGTCAAGAATCACACCTTTCTCGAGAAAGGTGTGATTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks