EMAIL THIS PAGE TO A FRIEND

GIN1

gypsy retrotransposon integrase 1

89 Gene Product Result for
Synonyms: GIN-1 TGIN1 ZH2C2
UniProtKB ID: Q9NXP7, B2RXF7, B4DIV4, Q6AI03, Q96BR2
Gene ID:
Mouse(252876) gypsy retrotransposon integrase 1
Rat(316687) gypsy retrotransposon integrase 1
chicken(427275) gypsy retrotransposon integrase 1
chicken(101669437) gypsy retrotransposon integrase 1
chicken(101750732) gypsy retrotransposon integrase 1
dog(488884) gypsy retrotransposon integrase 1
domestic cat(101084851) gypsy retrotransposon integrase 1
cow(504972) gypsy retrotransposon integrase 1
Horse(100064754) gypsy retrotransposon integrase 1
naked mole-rat(101718518) gypsy retrotransposon integrase 1
domestic guinea pig(100712979) gypsy retrotransposon integrase 1
sheep(101114015) gypsy retrotransposon integrase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017676 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017676 Rosetta Predictions human pricing
NM_001025012 Rosetta Predictions rat pricing
NM_026250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221482 predicted 808
2 SASI_Hs02_00350410 predicted 1636
3 SASI_Hs01_00221484 predicted 492
4 SASI_Hs02_00350411 predicted 854
5 SASI_Hs02_00350412 predicted 1735
6 SASI_Hs02_00350413 predicted 1556
7 SASI_Hs02_00350414 predicted 1443
8 SASI_Hs02_00350415 predicted 904
9 SASI_Hs01_00221487 predicted 748
10 SASI_Hs01_00221488 predicted 1341
11 SASI_Hs01_00221483 predicted 856
12 SASI_Hs01_00221485 predicted 799
13 SASI_Hs01_00221486 predicted 899
14 SASI_Hs01_00221489 predicted 1143
15 SASI_Hs01_00221490 predicted 1235
16 SASI_Hs01_00221491 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080661 predicted 304
2 SASI_Rn01_00080662 predicted 1615
3 SASI_Rn01_00080663 predicted 820
4 SASI_Rn01_00080666 predicted 515
5 SASI_Rn01_00080667 predicted 474
6 SASI_Rn01_00080668 predicted 1574
7 SASI_Rn01_00080669 predicted 1315
8 SASI_Rn01_00080670 predicted 1584
9 SASI_Rn02_00202918 predicted 362
10 SASI_Rn02_00202919 predicted 833
11 SASI_Rn01_00080664 predicted 1199
12 SASI_Rn01_00080665 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075783 predicted 1485
2 SASI_Mm02_00329933 predicted 1085
3 SASI_Mm01_00075784 predicted 1445
4 SASI_Mm01_00075785 predicted 1512
5 SASI_Mm01_00075786 predicted 1365
6 SASI_Mm01_00075787 predicted 426
7 SASI_Mm02_00329934 predicted 997
8 SASI_Mm01_00075789 predicted 353
9 SASI_Mm01_00075790 predicted 262
10 SASI_Mm02_00329935 predicted 1470
11 SASI_Mm01_00075788 predicted 1588
12 SASI_Mm01_00075791 predicted 1609
13 SASI_Mm01_00075792 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017676
GIN1 MISSION shRNA Bacterial Glycerol Stock
gypsy retrotransposon integrase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017676.2-1485s21c1
Sequence:CCGGCTATTGGTATAGTCGATAATGCTCGAGCATTATCGACTATACCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017676.2-632s21c1
Sequence:CCGGGAAGTTTCTAAAGCTATTATCCTCGAGGATAATAGCTTTAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-775s1c1
Sequence:CCGGCCTCTGGAACTGTTAACCCAACTCGAGTTGGGTTAACAGTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-848s1c1
Sequence:CCGGCCACCCAAACAATTGGGATGACTCGAGTCATCCCAATTGTTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-581s1c1
Sequence:CCGGGTTCACCAAATGGATTGTGATCTCGAGATCACAATCCATTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-879s1c1
Sequence:CCGGGCTGTTTCATTTGCCTTCAATCTCGAGATTGAAGGCAAATGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017676.1-1457s1c1
Sequence:CCGGGCAAATATTCTGGTGGAAGATCTCGAGATCTTCCACCAGAATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-126s1c1
Sequence:CCGGGCATATTACAAACGAACTGGTCTCGAGACCAGTTCGTTTGTAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017676
GIN1 MISSION shRNA shRNA Plasmid DNA
gypsy retrotransposon integrase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017676.2-1485s21c1
Sequence:CCGGCTATTGGTATAGTCGATAATGCTCGAGCATTATCGACTATACCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017676.2-632s21c1
Sequence:CCGGGAAGTTTCTAAAGCTATTATCCTCGAGGATAATAGCTTTAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-775s1c1
Sequence:CCGGCCTCTGGAACTGTTAACCCAACTCGAGTTGGGTTAACAGTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-848s1c1
Sequence:CCGGCCACCCAAACAATTGGGATGACTCGAGTCATCCCAATTGTTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-581s1c1
Sequence:CCGGGTTCACCAAATGGATTGTGATCTCGAGATCACAATCCATTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-879s1c1
Sequence:CCGGGCTGTTTCATTTGCCTTCAATCTCGAGATTGAAGGCAAATGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017676.1-1457s1c1
Sequence:CCGGGCAAATATTCTGGTGGAAGATCTCGAGATCTTCCACCAGAATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-126s1c1
Sequence:CCGGGCATATTACAAACGAACTGGTCTCGAGACCAGTTCGTTTGTAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017676
GIN1 MISSION shRNA Lentiviral Transduction Particles
gypsy retrotransposon integrase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017676.2-1485s21c1
Sequence:CCGGCTATTGGTATAGTCGATAATGCTCGAGCATTATCGACTATACCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017676.2-632s21c1
Sequence:CCGGGAAGTTTCTAAAGCTATTATCCTCGAGGATAATAGCTTTAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-775s1c1
Sequence:CCGGCCTCTGGAACTGTTAACCCAACTCGAGTTGGGTTAACAGTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-848s1c1
Sequence:CCGGCCACCCAAACAATTGGGATGACTCGAGTCATCCCAATTGTTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-581s1c1
Sequence:CCGGGTTCACCAAATGGATTGTGATCTCGAGATCACAATCCATTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-879s1c1
Sequence:CCGGGCTGTTTCATTTGCCTTCAATCTCGAGATTGAAGGCAAATGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017676.1-1457s1c1
Sequence:CCGGGCAAATATTCTGGTGGAAGATCTCGAGATCTTCCACCAGAATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017676.1-126s1c1
Sequence:CCGGGCATATTACAAACGAACTGGTCTCGAGACCAGTTCGTTTGTAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026250
VALIDATED
GIN1 MISSION shRNA Bacterial Glycerol Stock
gypsy retrotransposon integrase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-244s1c1
Sequence:CCGGCGTTTGGTAGTTGTTTCGGAACTCGAGTTCCGAAACAACTACCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-1121s1c1
Sequence:CCGGAGCAGTTAAATCCCTTTCATTCTCGAGAATGAAAGGGATTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-913s1c1
Sequence:CCGGCCGTATTTCCAAATGTTCAATCTCGAGATTGAACATTTGGAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-1122s1c1
Sequence:CCGGGCAGTTAAATCCCTTTCATTTCTCGAGAAATGAAAGGGATTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026250.1-1818s1c1
Sequence:CCGGCCATGCGTAGAATTCAGAAATCTCGAGATTTCTGAATTCTACGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026250
VALIDATED
GIN1 MISSION shRNA shRNA Plasmid DNA
gypsy retrotransposon integrase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-244s1c1
Sequence:CCGGCGTTTGGTAGTTGTTTCGGAACTCGAGTTCCGAAACAACTACCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-1121s1c1
Sequence:CCGGAGCAGTTAAATCCCTTTCATTCTCGAGAATGAAAGGGATTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-913s1c1
Sequence:CCGGCCGTATTTCCAAATGTTCAATCTCGAGATTGAACATTTGGAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-1122s1c1
Sequence:CCGGGCAGTTAAATCCCTTTCATTTCTCGAGAAATGAAAGGGATTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026250.1-1818s1c1
Sequence:CCGGCCATGCGTAGAATTCAGAAATCTCGAGATTTCTGAATTCTACGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026250
VALIDATED
GIN1 MISSION shRNA Lentiviral Transduction Particles
gypsy retrotransposon integrase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-244s1c1
Sequence:CCGGCGTTTGGTAGTTGTTTCGGAACTCGAGTTCCGAAACAACTACCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-1121s1c1
Sequence:CCGGAGCAGTTAAATCCCTTTCATTCTCGAGAATGAAAGGGATTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-913s1c1
Sequence:CCGGCCGTATTTCCAAATGTTCAATCTCGAGATTGAACATTTGGAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026250.1-1122s1c1
Sequence:CCGGGCAGTTAAATCCCTTTCATTTCTCGAGAAATGAAAGGGATTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026250.1-1818s1c1
Sequence:CCGGCCATGCGTAGAATTCAGAAATCTCGAGATTTCTGAATTCTACGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks