EMAIL THIS PAGE TO A FRIEND

GINM1

glycoprotein integral membrane 1

Synonyms: C6orf72 dJ12G14.2
UniProtKB ID: Q9NU53, B2RDY7, E1P5A2
Gene ID:
Mouse(215751) glycoprotein integral membrane 1
Rat(361448) glycoprotein integral membrane 1
dog(476239) glycoprotein integral membrane 1
domestic cat(101099210) glycoprotein integral membrane 1
cow(506714) glycoprotein integral membrane 1
domestic guinea pig(100717351) glycoprotein integral membrane 1
naked mole-rat(101696432) glycoprotein integral membrane 1
sheep(101104248) glycoprotein integral membrane 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138785 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138785 Rosetta Predictions human pricing
XM_001059108 Rosetta Predictions rat pricing
XM_001059157 Rosetta Predictions rat pricing
XM_341726 Rosetta Predictions rat pricing
NM_145418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095675 predicted 500
2 SASI_Hs01_00095676 predicted 459
3 SASI_Hs01_00095677 predicted 348
4 SASI_Hs02_00363908 predicted 206
5 SASI_Hs01_00095679 predicted 278
6 SASI_Hs01_00095680 predicted 858
7 SASI_Hs02_00363909 predicted 283
8 SASI_Hs02_00363910 predicted 275
9 SASI_Hs01_00095682 predicted 693
10 SASI_Hs01_00095683 predicted 399
11 SASI_Hs01_00095674 predicted 639
12 SASI_Hs01_00095678 predicted 516
13 SASI_Hs01_00095681 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291994 predicted 639
2 SASI_Rn02_00291995 predicted 683
3 SASI_Rn02_00291996 predicted 750
4 SASI_Rn02_00291997 predicted 379
5 SASI_Rn02_00291998 predicted 604
6 SASI_Rn02_00291999 predicted 529
7 SASI_Rn02_00292000 predicted 1005
8 SASI_Rn02_00292001 predicted 415
9 SASI_Rn02_00292002 predicted 480
10 SASI_Rn02_00292003 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292172 predicted 476
2 SASI_Rn02_00292173 predicted 517
3 SASI_Rn02_00292174 predicted 207
4 SASI_Rn02_00292175 predicted 443
5 SASI_Rn02_00292176 predicted 363
6 SASI_Rn02_00292177 predicted 832
7 SASI_Rn02_00292178 predicted 255
8 SASI_Rn02_00292179 predicted 590
9 SASI_Rn02_00292180 predicted 320
10 SASI_Rn02_00292181 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393283 predicted 670
2 SASI_Rn02_00393284 predicted 704
3 SASI_Rn02_00393285 predicted 402
4 SASI_Rn02_00393286 predicted 634
5 SASI_Rn02_00393287 predicted 1031
6 SASI_Rn02_00393288 predicted 323
7 SASI_Rn02_00393289 predicted 445
8 SASI_Rn02_00393290 predicted 357
9 SASI_Rn02_00393291 predicted 514
10 SASI_Rn02_00393292 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160308 predicted 514
2 SASI_Mm01_00160309 predicted 513
3 SASI_Mm01_00160310 predicted 205
4 SASI_Mm01_00160311 predicted 529
5 SASI_Mm01_00160312 predicted 280
6 SASI_Mm01_00160314 predicted 510
7 SASI_Mm01_00160315 predicted 672
8 SASI_Mm02_00340766 predicted 1112
9 SASI_Mm01_00160316 predicted 241
10 SASI_Mm01_00160317 predicted 230
11 SASI_Mm01_00160313 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138785
VALIDATED
GINM1 MISSION shRNA Bacterial Glycerol Stock
glycoprotein integral membrane 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_138785.1-939s1c1
Sequence:CCGGCATACCTGTGACAGCTATCAACTCGAGTTGATAGCTGTCACAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-238s1c1
Sequence:CCGGCAGGTGTATGTAAATGACTTACTCGAGTAAGTCATTTACATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-642s1c1
Sequence:CCGGCCAGTATCTTATCAGGAATGTCTCGAGACATTCCTGATAAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-427s1c1
Sequence:CCGGGAAGAGGTAGTAGAGATTGATCTCGAGATCAATCTCTACTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138785.1-424s1c1
Sequence:CCGGCAAGAAGAGGTAGTAGAGATTCTCGAGAATCTCTACTACCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_138785.1-613s1c1
Sequence:CCGGGAAAGTGTTAGTTCACTGCAACTCGAGTTGCAGTGAACTAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-540s21c1
Sequence:CCGGGAAAGCATGCTCTACTCTATTCTCGAGAATAGAGTAGAGCATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-505s21c1
Sequence:CCGGTACTCAGACATTCAAACTATACTCGAGTATAGTTTGAATGTCTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-827s21c1
Sequence:CCGGCATCATGGTGGTTGGAATTACCTCGAGGTAATTCCAACCACCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-719s21c1
Sequence:CCGGAGAGCCGCCATCTTCATATAACTCGAGTTATATGAAGATGGCGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138785
VALIDATED
GINM1 MISSION shRNA shRNA Plasmid DNA
glycoprotein integral membrane 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_138785.1-939s1c1
Sequence:CCGGCATACCTGTGACAGCTATCAACTCGAGTTGATAGCTGTCACAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-238s1c1
Sequence:CCGGCAGGTGTATGTAAATGACTTACTCGAGTAAGTCATTTACATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-642s1c1
Sequence:CCGGCCAGTATCTTATCAGGAATGTCTCGAGACATTCCTGATAAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-427s1c1
Sequence:CCGGGAAGAGGTAGTAGAGATTGATCTCGAGATCAATCTCTACTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138785.1-424s1c1
Sequence:CCGGCAAGAAGAGGTAGTAGAGATTCTCGAGAATCTCTACTACCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_138785.1-613s1c1
Sequence:CCGGGAAAGTGTTAGTTCACTGCAACTCGAGTTGCAGTGAACTAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-540s21c1
Sequence:CCGGGAAAGCATGCTCTACTCTATTCTCGAGAATAGAGTAGAGCATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-505s21c1
Sequence:CCGGTACTCAGACATTCAAACTATACTCGAGTATAGTTTGAATGTCTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-827s21c1
Sequence:CCGGCATCATGGTGGTTGGAATTACCTCGAGGTAATTCCAACCACCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-719s21c1
Sequence:CCGGAGAGCCGCCATCTTCATATAACTCGAGTTATATGAAGATGGCGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138785
VALIDATED
GINM1 MISSION shRNA Lentiviral Transduction Particles
glycoprotein integral membrane 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_138785.1-939s1c1
Sequence:CCGGCATACCTGTGACAGCTATCAACTCGAGTTGATAGCTGTCACAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-238s1c1
Sequence:CCGGCAGGTGTATGTAAATGACTTACTCGAGTAAGTCATTTACATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-642s1c1
Sequence:CCGGCCAGTATCTTATCAGGAATGTCTCGAGACATTCCTGATAAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138785.1-427s1c1
Sequence:CCGGGAAGAGGTAGTAGAGATTGATCTCGAGATCAATCTCTACTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138785.1-424s1c1
Sequence:CCGGCAAGAAGAGGTAGTAGAGATTCTCGAGAATCTCTACTACCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_138785.1-613s1c1
Sequence:CCGGGAAAGTGTTAGTTCACTGCAACTCGAGTTGCAGTGAACTAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-540s21c1
Sequence:CCGGGAAAGCATGCTCTACTCTATTCTCGAGAATAGAGTAGAGCATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-505s21c1
Sequence:CCGGTACTCAGACATTCAAACTATACTCGAGTATAGTTTGAATGTCTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-827s21c1
Sequence:CCGGCATCATGGTGGTTGGAATTACCTCGAGGTAATTCCAACCACCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138785.3-719s21c1
Sequence:CCGGAGAGCCGCCATCTTCATATAACTCGAGTTATATGAAGATGGCGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145418
VALIDATED
GINM1 MISSION shRNA Bacterial Glycerol Stock
glycoprotein integral membrane 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-288s1c1
Sequence:CCGGCCCGAATAAGCTGTCAGACTTCTCGAGAAGTCTGACAGCTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-1353s1c1
Sequence:CCGGGCTGGAGAACTTAACATTTATCTCGAGATAAATGTTAAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-868s1c1
Sequence:CCGGAGCAGGAGTCATAGCAGTGTTCTCGAGAACACTGCTATGACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-162s1c1
Sequence:CCGGGCATCCAAATCAATGTAACTACTCGAGTAGTTACATTGATTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-869s1c1
Sequence:CCGGGCAGGAGTCATAGCAGTGTTACTCGAGTAACACTGCTATGACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-869s21c1
Sequence:CCGGGCAGGAGTCATAGCAGTGTTACTCGAGTAACACTGCTATGACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-162s21c1
Sequence:CCGGGCATCCAAATCAATGTAACTACTCGAGTAGTTACATTGATTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145418.4-1367s21c1
Sequence:CCGGGCTGGAGAACTTAACATTTATCTCGAGATAAATGTTAAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-288s21c1
Sequence:CCGGCCCGAATAAGCTGTCAGACTTCTCGAGAAGTCTGACAGCTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145418
VALIDATED
GINM1 MISSION shRNA shRNA Plasmid DNA
glycoprotein integral membrane 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-288s1c1
Sequence:CCGGCCCGAATAAGCTGTCAGACTTCTCGAGAAGTCTGACAGCTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-1353s1c1
Sequence:CCGGGCTGGAGAACTTAACATTTATCTCGAGATAAATGTTAAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-868s1c1
Sequence:CCGGAGCAGGAGTCATAGCAGTGTTCTCGAGAACACTGCTATGACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-162s1c1
Sequence:CCGGGCATCCAAATCAATGTAACTACTCGAGTAGTTACATTGATTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-869s1c1
Sequence:CCGGGCAGGAGTCATAGCAGTGTTACTCGAGTAACACTGCTATGACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-869s21c1
Sequence:CCGGGCAGGAGTCATAGCAGTGTTACTCGAGTAACACTGCTATGACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-162s21c1
Sequence:CCGGGCATCCAAATCAATGTAACTACTCGAGTAGTTACATTGATTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145418.4-1367s21c1
Sequence:CCGGGCTGGAGAACTTAACATTTATCTCGAGATAAATGTTAAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-288s21c1
Sequence:CCGGCCCGAATAAGCTGTCAGACTTCTCGAGAAGTCTGACAGCTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145418
VALIDATED
GINM1 MISSION shRNA Lentiviral Transduction Particles
glycoprotein integral membrane 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-288s1c1
Sequence:CCGGCCCGAATAAGCTGTCAGACTTCTCGAGAAGTCTGACAGCTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-1353s1c1
Sequence:CCGGGCTGGAGAACTTAACATTTATCTCGAGATAAATGTTAAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-868s1c1
Sequence:CCGGAGCAGGAGTCATAGCAGTGTTCTCGAGAACACTGCTATGACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-162s1c1
Sequence:CCGGGCATCCAAATCAATGTAACTACTCGAGTAGTTACATTGATTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145418.1-869s1c1
Sequence:CCGGGCAGGAGTCATAGCAGTGTTACTCGAGTAACACTGCTATGACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-869s21c1
Sequence:CCGGGCAGGAGTCATAGCAGTGTTACTCGAGTAACACTGCTATGACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-162s21c1
Sequence:CCGGGCATCCAAATCAATGTAACTACTCGAGTAGTTACATTGATTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145418.4-1367s21c1
Sequence:CCGGGCTGGAGAACTTAACATTTATCTCGAGATAAATGTTAAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145418.4-288s21c1
Sequence:CCGGCCCGAATAAGCTGTCAGACTTCTCGAGAAGTCTGACAGCTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks