EMAIL THIS PAGE TO A FRIEND

GINS1

GINS complex subunit 1 (Psf1 homolog)

83 Gene Product Result for
Synonyms: PSF1
UniProtKB ID: Q14691, Q9NQE2, Q9NQI7
Gene ID:
Human(9837) Summary: The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1, Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]
Mouse(69270) GINS complex subunit 1 (Psf1 homolog)
Rat(499914) GINS complex subunit 1 (Psf1 homolog)
naked mole-rat(101715620) GINS complex subunit 1 (Psf1 homolog)
domestic guinea pig(100729290) GINS complex subunit 1 (Psf1 homolog)
Zebrafish(450061) GINS complex subunit 1 (Psf1 homolog)
chicken(416705) GINS complex subunit 1 (Psf1 homolog)
domestic cat(101091610) GINS complex subunit 1 (Psf1 homolog)
dog(477005) GINS complex subunit 1 (Psf1 homolog)
chicken(425297) GINS complex subunit 1 (Psf1 homolog)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021067 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_130416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015051 MISSION® esiRNA esiRNA targeting human GINS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021067 Rosetta Predictions human pricing
NM_001109207 Rosetta Predictions rat pricing
XM_130416 Rosetta Predictions mouse pricing
XM_902426 Rosetta Predictions mouse pricing
XM_902428 Rosetta Predictions mouse pricing
XM_918384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182852 predicted 300
2 SASI_Hs01_00182854 predicted 196
3 SASI_Hs02_00354535 predicted 414
4 SASI_Hs02_00354536 predicted 328
5 SASI_Hs02_00354537 predicted 260
6 SASI_Hs01_00182855 predicted 291
7 SASI_Hs02_00354538 predicted 390
8 SASI_Hs01_00182858 predicted 384
9 SASI_Hs02_00354539 predicted 285
10 SASI_Hs02_00354540 predicted 397
11 SASI_Hs01_00182850 predicted 403
12 SASI_Hs01_00182851 predicted 335
13 SASI_Hs01_00182853 predicted 245
14 SASI_Hs01_00182856 predicted 410
15 SASI_Hs01_00182857 predicted 289
16 SASI_Hs01_00182859 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246150 predicted 263
2 SASI_Rn02_00246151 predicted 417
3 SASI_Rn02_00246152 predicted 297
4 SASI_Rn02_00246153 predicted 412
5 SASI_Rn02_00246154 predicted 407
6 SASI_Rn02_00246155 predicted 392
7 SASI_Rn02_00246156 predicted 232
8 SASI_Rn02_00246157 predicted 259
9 SASI_Rn02_00246158 predicted 312
10 SASI_Rn02_00246159 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206808 predicted 316
2 SASI_Mm01_00206809 predicted 346
3 SASI_Mm01_00206810 predicted 349
4 SASI_Mm01_00206811 predicted 296
5 SASI_Mm01_00206812 predicted 232
6 SASI_Mm01_00206813 predicted 302
7 SASI_Mm01_00206814 predicted 318
8 SASI_Mm01_00206815 predicted 296
9 SASI_Mm01_00206816 predicted 315
10 SASI_Mm01_00206817 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251406 predicted 321
2 SASI_Mm01_00251407 predicted 350
3 SASI_Mm01_00251408 predicted 346
4 SASI_Mm01_00251409 predicted 297
5 SASI_Mm01_00251410 predicted 224
6 SASI_Mm01_00251411 predicted 300
7 SASI_Mm01_00251412 predicted 315
8 SASI_Mm01_00251413 predicted 293
9 SASI_Mm01_00251414 predicted 314
10 SASI_Mm01_00251415 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263421 predicted 407
2 SASI_Mm01_00263422 predicted 231
3 SASI_Mm01_00263423 predicted 407
4 SASI_Mm01_00263424 predicted 290
5 SASI_Mm01_00263425 predicted 385
6 SASI_Mm01_00263426 predicted 225
7 SASI_Mm01_00263427 predicted 419
8 SASI_Mm01_00263428 predicted 302
9 SASI_Mm01_00263429 predicted 407
10 SASI_Mm01_00263430 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_918384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441819 predicted 622
2 SASI_Mm02_00441820 predicted 819
3 SASI_Mm02_00441821 predicted 404
4 SASI_Mm02_00441822 predicted 196
5 SASI_Mm02_00441823 predicted 417
6 SASI_Mm02_00441824 predicted 294
7 SASI_Mm02_00441825 predicted 228
8 SASI_Mm02_00441826 predicted 673
9 SASI_Mm02_00441827 predicted 818
10 SASI_Mm02_00441828 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021067
VALIDATED
GINS1 MISSION shRNA Bacterial Glycerol Stock
GINS complex subunit 1 (Psf1 homolog)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-328s21c1
Sequence:CCGGGACACTGTTCTCTGTTAAGAACTCGAGTTCTTAACAGAGAACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-221s21c1
Sequence:CCGGCAGACAAGTTCTGGAGGAGATCTCGAGATCTCCTCCAGAACTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-1443s21c1
Sequence:CCGGGATCACCAGTATCACCACTTTCTCGAGAAAGTGGTGATACTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-1258s21c1
Sequence:CCGGGCTGAATTTCTGAGATACACACTCGAGTGTGTATCTCAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021067.2-1259s1c1
Sequence:CCGGGAGAGCTGAATTTCTGAGATACTCGAGTATCTCAGAAATTCAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021067.2-333s1c1
Sequence:CCGGGACACTGTTCTCTGTTAAGAACTCGAGTTCTTAACAGAGAACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-230s1c1
Sequence:CCGGCAAGTTCTGGAGGAGATGAAACTCGAGTTTCATCTCCTCCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021067.2-1448s1c1
Sequence:CCGGGATCACCAGTATCACCACTTTCTCGAGAAAGTGGTGATACTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021067.2-1263s1c1
Sequence:CCGGGCTGAATTTCTGAGATACACACTCGAGTGTGTATCTCAGAAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021067.2-239s1c1
Sequence:CCGGGAGGAGATGAAAGCTTTGTATCTCGAGATACAAAGCTTTCATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-226s1c1
Sequence:CCGGCAGACAAGTTCTGGAGGAGATCTCGAGATCTCCTCCAGAACTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021067.2-430s1c1
Sequence:CCGGCTTGCCAAATGCATTACGATTCTCGAGAATCGTAATGCATTTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-215s1c1
Sequence:CCGGGAGGATGGACTCAGACAAGTTCTCGAGAACTTGTCTGAGTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021067
VALIDATED
GINS1 MISSION shRNA shRNA Plasmid DNA
GINS complex subunit 1 (Psf1 homolog)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-328s21c1
Sequence:CCGGGACACTGTTCTCTGTTAAGAACTCGAGTTCTTAACAGAGAACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-221s21c1
Sequence:CCGGCAGACAAGTTCTGGAGGAGATCTCGAGATCTCCTCCAGAACTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-1443s21c1
Sequence:CCGGGATCACCAGTATCACCACTTTCTCGAGAAAGTGGTGATACTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-1258s21c1
Sequence:CCGGGCTGAATTTCTGAGATACACACTCGAGTGTGTATCTCAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021067.2-1259s1c1
Sequence:CCGGGAGAGCTGAATTTCTGAGATACTCGAGTATCTCAGAAATTCAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021067.2-333s1c1
Sequence:CCGGGACACTGTTCTCTGTTAAGAACTCGAGTTCTTAACAGAGAACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-230s1c1
Sequence:CCGGCAAGTTCTGGAGGAGATGAAACTCGAGTTTCATCTCCTCCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021067.2-1448s1c1
Sequence:CCGGGATCACCAGTATCACCACTTTCTCGAGAAAGTGGTGATACTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021067.2-1263s1c1
Sequence:CCGGGCTGAATTTCTGAGATACACACTCGAGTGTGTATCTCAGAAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021067.2-239s1c1
Sequence:CCGGGAGGAGATGAAAGCTTTGTATCTCGAGATACAAAGCTTTCATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-226s1c1
Sequence:CCGGCAGACAAGTTCTGGAGGAGATCTCGAGATCTCCTCCAGAACTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021067.2-430s1c1
Sequence:CCGGCTTGCCAAATGCATTACGATTCTCGAGAATCGTAATGCATTTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-215s1c1
Sequence:CCGGGAGGATGGACTCAGACAAGTTCTCGAGAACTTGTCTGAGTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021067
VALIDATED
GINS1 MISSION shRNA Lentiviral Transduction Particles
GINS complex subunit 1 (Psf1 homolog)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-328s21c1
Sequence:CCGGGACACTGTTCTCTGTTAAGAACTCGAGTTCTTAACAGAGAACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-221s21c1
Sequence:CCGGCAGACAAGTTCTGGAGGAGATCTCGAGATCTCCTCCAGAACTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-1443s21c1
Sequence:CCGGGATCACCAGTATCACCACTTTCTCGAGAAAGTGGTGATACTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021067.3-1258s21c1
Sequence:CCGGGCTGAATTTCTGAGATACACACTCGAGTGTGTATCTCAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021067.2-1259s1c1
Sequence:CCGGGAGAGCTGAATTTCTGAGATACTCGAGTATCTCAGAAATTCAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021067.2-333s1c1
Sequence:CCGGGACACTGTTCTCTGTTAAGAACTCGAGTTCTTAACAGAGAACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-230s1c1
Sequence:CCGGCAAGTTCTGGAGGAGATGAAACTCGAGTTTCATCTCCTCCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021067.2-1448s1c1
Sequence:CCGGGATCACCAGTATCACCACTTTCTCGAGAAAGTGGTGATACTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021067.2-1263s1c1
Sequence:CCGGGCTGAATTTCTGAGATACACACTCGAGTGTGTATCTCAGAAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021067.2-239s1c1
Sequence:CCGGGAGGAGATGAAAGCTTTGTATCTCGAGATACAAAGCTTTCATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-226s1c1
Sequence:CCGGCAGACAAGTTCTGGAGGAGATCTCGAGATCTCCTCCAGAACTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021067.2-430s1c1
Sequence:CCGGCTTGCCAAATGCATTACGATTCTCGAGAATCGTAATGCATTTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021067.2-215s1c1
Sequence:CCGGGAGGATGGACTCAGACAAGTTCTCGAGAACTTGTCTGAGTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130416
GINS1 MISSION shRNA Bacterial Glycerol Stock
GINS complex subunit 1 (Psf1 homolog)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-465s21c1
Sequence:CCGGCGGAGTGGTTCAACCATTATACTCGAGTATAATGGTTGAACCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-303s21c1
Sequence:CCGGATCTGATACCAACCGTCAAATCTCGAGATTTGACGGTTGGTATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-572s21c1
Sequence:CCGGTATATTGAAGTGCGGTGTTTACTCGAGTAAACACCGCACTTCAATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-375s21c1
Sequence:CCGGATGACCGGTTGCTTCGGATTACTCGAGTAATCCGAAGCAACCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_130416.6-869s21c1
Sequence:CCGGTAGAGCACCTGCTTAGGATTTCTCGAGAAATCCTAAGCAGGTGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130416
GINS1 MISSION shRNA shRNA Plasmid DNA
GINS complex subunit 1 (Psf1 homolog)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-465s21c1
Sequence:CCGGCGGAGTGGTTCAACCATTATACTCGAGTATAATGGTTGAACCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-303s21c1
Sequence:CCGGATCTGATACCAACCGTCAAATCTCGAGATTTGACGGTTGGTATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-572s21c1
Sequence:CCGGTATATTGAAGTGCGGTGTTTACTCGAGTAAACACCGCACTTCAATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-375s21c1
Sequence:CCGGATGACCGGTTGCTTCGGATTACTCGAGTAATCCGAAGCAACCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_130416.6-869s21c1
Sequence:CCGGTAGAGCACCTGCTTAGGATTTCTCGAGAAATCCTAAGCAGGTGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130416
GINS1 MISSION shRNA Lentiviral Transduction Particles
GINS complex subunit 1 (Psf1 homolog)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-465s21c1
Sequence:CCGGCGGAGTGGTTCAACCATTATACTCGAGTATAATGGTTGAACCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-303s21c1
Sequence:CCGGATCTGATACCAACCGTCAAATCTCGAGATTTGACGGTTGGTATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-572s21c1
Sequence:CCGGTATATTGAAGTGCGGTGTTTACTCGAGTAAACACCGCACTTCAATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_130416.6-375s21c1
Sequence:CCGGATGACCGGTTGCTTCGGATTACTCGAGTAATCCGAAGCAACCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_130416.6-869s21c1
Sequence:CCGGTAGAGCACCTGCTTAGGATTTCTCGAGAAATCCTAAGCAGGTGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks