EMAIL THIS PAGE TO A FRIEND

GINS2

GINS complex subunit 2 (Psf2 homolog)

49 Gene Product Result for
Synonyms: HSPC037 PSF2 Pfs2
UniProtKB ID: Q9Y248, D3DUM5, Q6IAG9
Gene ID:
Human(51659) Summary: The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1 (GINS1; MIM 610608), Psf2, and Psf3 (GINS3; MIM 610610). The formation of this complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]
Mouse(272551) GINS complex subunit 2 (Psf2 homolog)
Rat(292058) GINS complex subunit 2 (Psf2 homolog)
Zebrafish(554146) GINS complex subunit 2
cow(100299171) GINS complex subunit 2 (Psf2 homolog)
chicken(415824) GINS complex subunit 2 (Psf2 homolog)
dog(609436) GINS complex subunit 2 (Psf2 homolog)
domestic cat(101089666) GINS complex subunit 2 (Psf2 homolog)
domestic guinea pig(100725875) GINS complex subunit 2 (Psf2 homolog)
naked mole-rat(101704298) GINS complex subunit 2 (Psf2 homolog)
sheep(101103005) GINS complex subunit 2 (Psf2 homolog)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016095 Rosetta Predictions human pricing
NM_001106190 Rosetta Predictions rat pricing
NM_178856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021654 predicted 359
2 SASI_Hs01_00021655 predicted 425
3 SASI_Hs01_00021657 predicted 293
4 SASI_Hs02_00348857 predicted 307
5 SASI_Hs02_00348858 predicted 432
6 SASI_Hs01_00021658 predicted 885
7 SASI_Hs01_00021659 predicted 362
8 SASI_Hs01_00021660 predicted 618
9 SASI_Hs01_00021661 predicted 749
10 SASI_Hs01_00021662 predicted 505
11 SASI_Hs01_00021656 predicted 786
12 SASI_Hs01_00021663 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216518 predicted 617
2 SASI_Rn02_00216519 predicted 945
3 SASI_Rn02_00216520 predicted 927
4 SASI_Rn02_00216521 predicted 325
5 SASI_Rn02_00216522 predicted 474
6 SASI_Rn02_00216523 predicted 1095
7 SASI_Rn02_00216524 predicted 1022
8 SASI_Rn02_00216525 predicted 979
9 SASI_Rn02_00216526 predicted 572
10 SASI_Rn02_00216527 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349434 predicted 547
2 SASI_Mm02_00349435 predicted 441
3 SASI_Mm02_00349436 predicted 799
4 SASI_Mm02_00349437 predicted 700
5 SASI_Mm02_00349438 predicted 732
6 SASI_Mm02_00349439 predicted 232
7 SASI_Mm02_00349440 predicted 671
8 SASI_Mm02_00349441 predicted 693
9 SASI_Mm02_00349442 predicted 556
10 SASI_Mm02_00349443 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016095
VALIDATED
GINS2 MISSION shRNA Bacterial Glycerol Stock
GINS complex subunit 2 (Psf2 homolog)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-1030s1c1
Sequence:CCGGCCTTCTTGATCCTGATTTCTTCTCGAGAAGAAATCAGGATCAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016095.1-223s1c1
Sequence:CCGGGCGATTAACCTGAAACAAAGACTCGAGTCTTTGTTTCAGGTTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-757s1c1
Sequence:CCGGGAATGGATTCAGGATGTTGTTCTCGAGAACAACATCCTGAATCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-1029s1c1
Sequence:CCGGCCCTTCTTGATCCTGATTTCTCTCGAGAGAAATCAGGATCAAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016095.1-361s1c1
Sequence:CCGGCTTACGAAGCTCCTGTTAAATCTCGAGATTTAACAGGAGCTTCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-403s21c1
Sequence:CCGGATCCCGAAGGCAGACGAAATCCTCGAGGATTTCGTCTGCCTTCGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-763s21c1
Sequence:CCGGGAATGGATTCAGGATGTTGTTCTCGAGAACAACATCCTGAATCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-229s21c1
Sequence:CCGGGCGATTAACCTGAAACAAAGACTCGAGTCTTTGTTTCAGGTTAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-541s21c1
Sequence:CCGGATCAACACCAGCGGGACTTTCCTCGAGGAAAGTCCCGCTGGTGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016095
VALIDATED
GINS2 MISSION shRNA shRNA Plasmid DNA
GINS complex subunit 2 (Psf2 homolog)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-1030s1c1
Sequence:CCGGCCTTCTTGATCCTGATTTCTTCTCGAGAAGAAATCAGGATCAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016095.1-223s1c1
Sequence:CCGGGCGATTAACCTGAAACAAAGACTCGAGTCTTTGTTTCAGGTTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-757s1c1
Sequence:CCGGGAATGGATTCAGGATGTTGTTCTCGAGAACAACATCCTGAATCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-1029s1c1
Sequence:CCGGCCCTTCTTGATCCTGATTTCTCTCGAGAGAAATCAGGATCAAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016095.1-361s1c1
Sequence:CCGGCTTACGAAGCTCCTGTTAAATCTCGAGATTTAACAGGAGCTTCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-403s21c1
Sequence:CCGGATCCCGAAGGCAGACGAAATCCTCGAGGATTTCGTCTGCCTTCGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-763s21c1
Sequence:CCGGGAATGGATTCAGGATGTTGTTCTCGAGAACAACATCCTGAATCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-229s21c1
Sequence:CCGGGCGATTAACCTGAAACAAAGACTCGAGTCTTTGTTTCAGGTTAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-541s21c1
Sequence:CCGGATCAACACCAGCGGGACTTTCCTCGAGGAAAGTCCCGCTGGTGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016095
VALIDATED
GINS2 MISSION shRNA Lentiviral Transduction Particles
GINS complex subunit 2 (Psf2 homolog)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-1030s1c1
Sequence:CCGGCCTTCTTGATCCTGATTTCTTCTCGAGAAGAAATCAGGATCAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016095.1-223s1c1
Sequence:CCGGGCGATTAACCTGAAACAAAGACTCGAGTCTTTGTTTCAGGTTAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-757s1c1
Sequence:CCGGGAATGGATTCAGGATGTTGTTCTCGAGAACAACATCCTGAATCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016095.1-1029s1c1
Sequence:CCGGCCCTTCTTGATCCTGATTTCTCTCGAGAGAAATCAGGATCAAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016095.1-361s1c1
Sequence:CCGGCTTACGAAGCTCCTGTTAAATCTCGAGATTTAACAGGAGCTTCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-403s21c1
Sequence:CCGGATCCCGAAGGCAGACGAAATCCTCGAGGATTTCGTCTGCCTTCGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-763s21c1
Sequence:CCGGGAATGGATTCAGGATGTTGTTCTCGAGAACAACATCCTGAATCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-229s21c1
Sequence:CCGGGCGATTAACCTGAAACAAAGACTCGAGTCTTTGTTTCAGGTTAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016095.2-541s21c1
Sequence:CCGGATCAACACCAGCGGGACTTTCCTCGAGGAAAGTCCCGCTGGTGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178856
VALIDATED
GINS2 MISSION shRNA Bacterial Glycerol Stock
GINS complex subunit 2 (Psf2 homolog)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-200s21c1
Sequence:CCGGGGCTGGCCATTAACCTGAAACCTCGAGGTTTCAGGTTAATGGCCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-270s21c1
Sequence:CCGGACTGGAACAGATGCGTGATGACTCGAGTCATCACGCATCTGTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-104s21c1
Sequence:CCGGTGACTATCATCCCGAACTTCACTCGAGTGAAGTTCGGGATGATAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-837s21c1
Sequence:CCGGTTCAAGCTTGGCCCGTGGAAACTCGAGTTTCCACGGGCCAAGCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-394s21c1
Sequence:CCGGACCATCCGGACACTGATCAAACTCGAGTTTGATCAGTGTCCGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178856
VALIDATED
GINS2 MISSION shRNA shRNA Plasmid DNA
GINS complex subunit 2 (Psf2 homolog)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-200s21c1
Sequence:CCGGGGCTGGCCATTAACCTGAAACCTCGAGGTTTCAGGTTAATGGCCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-270s21c1
Sequence:CCGGACTGGAACAGATGCGTGATGACTCGAGTCATCACGCATCTGTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-104s21c1
Sequence:CCGGTGACTATCATCCCGAACTTCACTCGAGTGAAGTTCGGGATGATAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-837s21c1
Sequence:CCGGTTCAAGCTTGGCCCGTGGAAACTCGAGTTTCCACGGGCCAAGCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-394s21c1
Sequence:CCGGACCATCCGGACACTGATCAAACTCGAGTTTGATCAGTGTCCGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178856
VALIDATED
GINS2 MISSION shRNA Lentiviral Transduction Particles
GINS complex subunit 2 (Psf2 homolog)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-200s21c1
Sequence:CCGGGGCTGGCCATTAACCTGAAACCTCGAGGTTTCAGGTTAATGGCCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-270s21c1
Sequence:CCGGACTGGAACAGATGCGTGATGACTCGAGTCATCACGCATCTGTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-104s21c1
Sequence:CCGGTGACTATCATCCCGAACTTCACTCGAGTGAAGTTCGGGATGATAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-837s21c1
Sequence:CCGGTTCAAGCTTGGCCCGTGGAAACTCGAGTTTCCACGGGCCAAGCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178856.1-394s21c1
Sequence:CCGGACCATCCGGACACTGATCAAACTCGAGTTTGATCAGTGTCCGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)