EMAIL THIS PAGE TO A FRIEND

GINS3

GINS complex subunit 3 (Psf3 homolog)

Synonyms: PSF3
UniProtKB ID: Q9BRX5, B2RDP3, E9PB21, Q9H870
Gene ID:
Human(64785) Summary: This gene encodes a protein subunit of the GINS heterotetrameric complex, which is essential for the initiation of DNA replication and replisome progression in eukaryotes. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(78833) GINS complex subunit 3 (Psf3 homolog)
Rat(307639) GINS complex subunit 3 (Psf3 homolog)
sheep(101105096) GINS complex subunit 3 (Psf3 homolog)
naked mole-rat(101716698) GINS complex subunit 3 (Psf3 homolog)
domestic guinea pig(100719050) GINS complex subunit 3 (Psf3 homolog)
Zebrafish(442931) GINS complex subunit 3
cow(538943) GINS complex subunit 3 (Psf3 homolog)
domestic cat(101088800) GINS complex subunit 3 (Psf3 homolog)
chicken(415625) GINS complex subunit 3 (Psf3 homolog)
dog(487254) GINS complex subunit 3 (Psf3 homolog)
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022770 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083891 MISSION® esiRNA esiRNA human GINS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126129 Rosetta Predictions human pricing
NM_001126130 Rosetta Predictions human pricing
NM_022770 Rosetta Predictions human pricing
NM_001107408 Rosetta Predictions rat pricing
NM_030198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328307 predicted 984
2 SASI_Hs02_00328308 predicted 1363
3 SASI_Hs02_00328309 predicted 1061
4 SASI_Hs02_00328310 predicted 1309
5 SASI_Hs02_00328311 predicted 957
6 SASI_Hs02_00328312 predicted 1034
7 SASI_Hs02_00328313 predicted 1412
8 SASI_Hs02_00328314 predicted 1332
9 SASI_Hs02_00328315 predicted 1276
10 SASI_Hs02_00328316 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328317 predicted 633
2 SASI_Hs02_00328318 predicted 1010
3 SASI_Hs02_00328319 predicted 712
4 SASI_Hs02_00328320 predicted 961
5 SASI_Hs02_00328321 predicted 598
6 SASI_Hs02_00328322 predicted 680
7 SASI_Hs02_00328323 predicted 1065
8 SASI_Hs02_00328324 predicted 977
9 SASI_Hs02_00328325 predicted 928
10 SASI_Hs02_00328326 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128906 predicted 868
2 SASI_Hs02_00356055 predicted 1248
3 SASI_Hs02_00356056 predicted 943
4 SASI_Hs02_00356057 predicted 1201
5 SASI_Hs01_00128908 predicted 836
6 SASI_Hs02_00356058 predicted 914
7 SASI_Hs02_00356059 predicted 1300
8 SASI_Hs02_00356060 predicted 1207
9 SASI_Hs02_00356061 predicted 1162
10 SASI_Hs01_00128910 predicted 1110
11 SASI_Hs01_00128907 predicted 639
12 SASI_Hs01_00128909 predicted 625
13 SASI_Hs01_00128911 predicted 857
14 SASI_Hs01_00128912 predicted 986
15 SASI_Hs01_00128913 predicted 746
16 SASI_Hs01_00128914 predicted 680
17 SASI_Hs01_00128915 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228525 predicted 630
2 SASI_Rn02_00228526 predicted 318
3 SASI_Rn02_00228527 predicted 608
4 SASI_Rn02_00228528 predicted 741
5 SASI_Rn02_00228529 predicted 1028
6 SASI_Rn02_00228530 predicted 971
7 SASI_Rn02_00228531 predicted 271
8 SASI_Rn02_00228532 predicted 696
9 SASI_Rn02_00228533 predicted 520
10 SASI_Rn02_00228534 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050163 predicted 1040
2 SASI_Mm01_00050165 predicted 328
3 SASI_Mm01_00050166 predicted 758
4 SASI_Mm01_00050167 predicted 1053
5 SASI_Mm01_00050168 predicted 742
6 SASI_Mm02_00336620 predicted 584
7 SASI_Mm01_00050169 predicted 966
8 SASI_Mm01_00050170 predicted 495
9 SASI_Mm01_00050171 predicted 692
10 SASI_Mm01_00050172 predicted 248
11 SASI_Mm01_00050164 predicted 966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030198
VALIDATED
GINS3 MISSION shRNA Bacterial Glycerol Stock
GINS complex subunit 3 (Psf3 homolog)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-638s21c1
Sequence:CCGGCCAGCCTCGTCCAGAATTATACTCGAGTATAATTCTGGACGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030198.3-1456s21c1
Sequence:CCGGCCACATATATGCGAATCTATACTCGAGTATAGATTCGCATATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-422s21c1
Sequence:CCGGGTCCGGAGAATGCAGATATTTCTCGAGAAATATCTGCATTCTCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030198.3-1456s1c1
Sequence:CCGGCCACATATATGCGAATCTATACTCGAGTATAGATTCGCATATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-571s21c1
Sequence:CCGGATCGGGCAGAGAAGTCTAAATCTCGAGATTTAGACTTCTCTGCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030198.3-318s21c1
Sequence:CCGGAGAGGGATGGAGGACTGTATTCTCGAGAATACAGTCCTCCATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030198.1-574s1c1
Sequence:CCGGCGGGCAGAGAAGTCTAAATGACTCGAGTCATTTAGACTTCTCTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030198.1-561s1c1
Sequence:CCGGGCTTATTTCAAATCGGGCAGACTCGAGTCTGCCCGATTTGAAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030198
VALIDATED
GINS3 MISSION shRNA shRNA Plasmid DNA
GINS complex subunit 3 (Psf3 homolog)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-638s21c1
Sequence:CCGGCCAGCCTCGTCCAGAATTATACTCGAGTATAATTCTGGACGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030198.3-1456s21c1
Sequence:CCGGCCACATATATGCGAATCTATACTCGAGTATAGATTCGCATATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-422s21c1
Sequence:CCGGGTCCGGAGAATGCAGATATTTCTCGAGAAATATCTGCATTCTCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030198.3-1456s1c1
Sequence:CCGGCCACATATATGCGAATCTATACTCGAGTATAGATTCGCATATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-571s21c1
Sequence:CCGGATCGGGCAGAGAAGTCTAAATCTCGAGATTTAGACTTCTCTGCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030198.3-318s21c1
Sequence:CCGGAGAGGGATGGAGGACTGTATTCTCGAGAATACAGTCCTCCATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030198.1-574s1c1
Sequence:CCGGCGGGCAGAGAAGTCTAAATGACTCGAGTCATTTAGACTTCTCTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030198.1-561s1c1
Sequence:CCGGGCTTATTTCAAATCGGGCAGACTCGAGTCTGCCCGATTTGAAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030198
VALIDATED
GINS3 MISSION shRNA Lentiviral Transduction Particles
GINS complex subunit 3 (Psf3 homolog)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-638s21c1
Sequence:CCGGCCAGCCTCGTCCAGAATTATACTCGAGTATAATTCTGGACGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030198.3-1456s21c1
Sequence:CCGGCCACATATATGCGAATCTATACTCGAGTATAGATTCGCATATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-422s21c1
Sequence:CCGGGTCCGGAGAATGCAGATATTTCTCGAGAAATATCTGCATTCTCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030198.3-1456s1c1
Sequence:CCGGCCACATATATGCGAATCTATACTCGAGTATAGATTCGCATATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030198.3-571s21c1
Sequence:CCGGATCGGGCAGAGAAGTCTAAATCTCGAGATTTAGACTTCTCTGCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030198.3-318s21c1
Sequence:CCGGAGAGGGATGGAGGACTGTATTCTCGAGAATACAGTCCTCCATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030198.1-574s1c1
Sequence:CCGGCGGGCAGAGAAGTCTAAATGACTCGAGTCATTTAGACTTCTCTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030198.1-561s1c1
Sequence:CCGGGCTTATTTCAAATCGGGCAGACTCGAGTCTGCCCGATTTGAAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022770
VALIDATED
GINS3 MISSION shRNA Bacterial Glycerol Stock
GINS complex subunit 3 (Psf3 homolog)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022770.3-807s21c1
Sequence:CCGGCCAACCTCGTTCAGAATTACACTCGAGTGTAATTCTGAACGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022770.3-842s21c1
Sequence:CCGGACTGATATGGAAGACTGAAAGCTCGAGCTTTCAGTCTTCCATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022770.3-1465s21c1
Sequence:CCGGATGTTGGCCTCATACTCTATACTCGAGTATAGAGTATGAGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022770.3-741s21c1
Sequence:CCGGCAGGGCAGAAAGGACTGAATGCTCGAGCATTCAGTCCTTTCTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022770.3-442s21c1
Sequence:CCGGCAACAAGCGACGGATCCTTTCCTCGAGGAAAGGATCCGTCGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022770.2-1618s1c1
Sequence:CCGGGCAAGTGTAAATGGGCAAGAACTCGAGTTCTTGCCCATTTACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022770.2-349s1c1
Sequence:CCGGCCAAGATCTACCAAGAGGGTTCTCGAGAACCCTCTTGGTAGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022770.2-683s1c1
Sequence:CCGGCAACCTCGTTCAGAATTACAACTCGAGTTGTAATTCTGAACGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022770
VALIDATED
GINS3 MISSION shRNA shRNA Plasmid DNA
GINS complex subunit 3 (Psf3 homolog)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022770.3-807s21c1
Sequence:CCGGCCAACCTCGTTCAGAATTACACTCGAGTGTAATTCTGAACGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022770.3-842s21c1
Sequence:CCGGACTGATATGGAAGACTGAAAGCTCGAGCTTTCAGTCTTCCATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022770.3-1465s21c1
Sequence:CCGGATGTTGGCCTCATACTCTATACTCGAGTATAGAGTATGAGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022770.3-741s21c1
Sequence:CCGGCAGGGCAGAAAGGACTGAATGCTCGAGCATTCAGTCCTTTCTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022770.3-442s21c1
Sequence:CCGGCAACAAGCGACGGATCCTTTCCTCGAGGAAAGGATCCGTCGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022770.2-1618s1c1
Sequence:CCGGGCAAGTGTAAATGGGCAAGAACTCGAGTTCTTGCCCATTTACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022770.2-349s1c1
Sequence:CCGGCCAAGATCTACCAAGAGGGTTCTCGAGAACCCTCTTGGTAGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022770.2-683s1c1
Sequence:CCGGCAACCTCGTTCAGAATTACAACTCGAGTTGTAATTCTGAACGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022770
VALIDATED
GINS3 MISSION shRNA Lentiviral Transduction Particles
GINS complex subunit 3 (Psf3 homolog)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022770.3-807s21c1
Sequence:CCGGCCAACCTCGTTCAGAATTACACTCGAGTGTAATTCTGAACGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022770.3-842s21c1
Sequence:CCGGACTGATATGGAAGACTGAAAGCTCGAGCTTTCAGTCTTCCATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022770.3-1465s21c1
Sequence:CCGGATGTTGGCCTCATACTCTATACTCGAGTATAGAGTATGAGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022770.3-741s21c1
Sequence:CCGGCAGGGCAGAAAGGACTGAATGCTCGAGCATTCAGTCCTTTCTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022770.3-442s21c1
Sequence:CCGGCAACAAGCGACGGATCCTTTCCTCGAGGAAAGGATCCGTCGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022770.2-1618s1c1
Sequence:CCGGGCAAGTGTAAATGGGCAAGAACTCGAGTTCTTGCCCATTTACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022770.2-349s1c1
Sequence:CCGGCCAAGATCTACCAAGAGGGTTCTCGAGAACCCTCTTGGTAGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022770.2-683s1c1
Sequence:CCGGCAACCTCGTTCAGAATTACAACTCGAGTTGTAATTCTGAACGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks