EMAIL THIS PAGE TO A FRIEND

GINS4

GINS complex subunit 4 (Sld5 homolog)

50 Gene Product Result for
Synonyms: SLD5
UniProtKB ID: Q9BRT9, B2R8H5, D3DSY0, Q8N648
Gene ID:
Human(84296) Summary: The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]
Mouse(109145) GINS complex subunit 4 (Sld5 homolog)
Rat(290842) GINS complex subunit 4 (Sld5 homolog)
Zebrafish(572562) GINS complex subunit 4 (Sld5 homolog)
cow(616799) GINS complex subunit 4 (Sld5 homolog)
domestic cat(101082647) GINS complex subunit 4 (Sld5 homolog)
dog(482843) GINS complex subunit 4 (Sld5 homolog)
chicken(770899) GINS complex subunit 4 (Sld5 homolog)
domestic guinea pig(100723702) GINS complex subunit 4 (Sld5 homolog)
naked mole-rat(101718029) GINS complex subunit 4 (Sld5 homolog)
sheep(101116959) GINS complex subunit 4 (Sld5 homolog)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032336 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032336 Rosetta Predictions human pricing
NM_001030027 Rosetta Predictions rat pricing
NM_024240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123763 predicted 318
2 SASI_Hs01_00123764 predicted 330
3 SASI_Hs02_00359719 predicted 575
4 SASI_Hs01_00123765 predicted 242
5 SASI_Hs01_00123766 predicted 494
6 SASI_Hs01_00123767 predicted 315
7 SASI_Hs01_00123768 predicted 575
8 SASI_Hs01_00123769 predicted 466
9 SASI_Hs01_00123770 predicted 239
10 SASI_Hs02_00359720 predicted 451
11 SASI_Hs01_00123762 predicted 334
12 SASI_Hs01_00123771 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109016 predicted 296
2 SASI_Rn01_00109017 predicted 407
3 SASI_Rn01_00109018 predicted 328
4 SASI_Rn01_00109019 predicted 325
5 SASI_Rn01_00109020 predicted 405
6 SASI_Rn01_00109021 predicted 641
7 SASI_Rn01_00109023 predicted 299
8 SASI_Rn01_00109024 predicted 532
9 SASI_Rn02_00203534 predicted 300
10 SASI_Rn01_00109025 predicted 355
11 SASI_Rn01_00109022 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063762 predicted 583
2 SASI_Mm01_00063763 predicted 816
3 SASI_Mm01_00063764 predicted 356
4 SASI_Mm01_00063765 predicted 708
5 SASI_Mm01_00063766 predicted 214
6 SASI_Mm01_00063767 predicted 461
7 SASI_Mm01_00063768 predicted 1036
8 SASI_Mm01_00063769 predicted 1094
9 SASI_Mm01_00063770 predicted 477
10 SASI_Mm01_00063771 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024240
VALIDATED
GINS4 MISSION shRNA Bacterial Glycerol Stock
GINS complex subunit 4 (Sld5 homolog)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024240.3-1047s1c1
Sequence:CCGGCCTTCTCCTAAATTCCTGTTTCTCGAGAAACAGGAATTTAGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024240.3-1046s1c1
Sequence:CCGGGCCTTCTCCTAAATTCCTGTTCTCGAGAACAGGAATTTAGGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024240.3-369s1c1
Sequence:CCGGGAATGCGTCATGGAACAGCTTCTCGAGAAGCTGTTCCATGACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024240.5-472s1c1
Sequence:CCGGCTATGTCCTCAGCAGCTATTTCTCGAGAAATAGCTGCTGAGGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-711s21c1
Sequence:CCGGACCTAGATTCATACGTGTTTCCTCGAGGAAACACGTATGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-864s21c1
Sequence:CCGGCTGGAGCAGTTCAGCTAATATCTCGAGATATTAGCTGAACTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-783s21c1
Sequence:CCGGAGCAGAGAGACTACGTGATTGCTCGAGCAATCACGTAGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-993s21c1
Sequence:CCGGGGACCACTTGGACGTAGAAAGCTCGAGCTTTCTACGTCCAAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-473s21c1
Sequence:CCGGTATGTCCTCAGCAGCTATTTGCTCGAGCAAATAGCTGCTGAGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024240
VALIDATED
GINS4 MISSION shRNA shRNA Plasmid DNA
GINS complex subunit 4 (Sld5 homolog)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024240.3-1047s1c1
Sequence:CCGGCCTTCTCCTAAATTCCTGTTTCTCGAGAAACAGGAATTTAGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024240.3-1046s1c1
Sequence:CCGGGCCTTCTCCTAAATTCCTGTTCTCGAGAACAGGAATTTAGGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024240.3-369s1c1
Sequence:CCGGGAATGCGTCATGGAACAGCTTCTCGAGAAGCTGTTCCATGACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024240.5-472s1c1
Sequence:CCGGCTATGTCCTCAGCAGCTATTTCTCGAGAAATAGCTGCTGAGGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-711s21c1
Sequence:CCGGACCTAGATTCATACGTGTTTCCTCGAGGAAACACGTATGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-864s21c1
Sequence:CCGGCTGGAGCAGTTCAGCTAATATCTCGAGATATTAGCTGAACTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-783s21c1
Sequence:CCGGAGCAGAGAGACTACGTGATTGCTCGAGCAATCACGTAGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-993s21c1
Sequence:CCGGGGACCACTTGGACGTAGAAAGCTCGAGCTTTCTACGTCCAAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-473s21c1
Sequence:CCGGTATGTCCTCAGCAGCTATTTGCTCGAGCAAATAGCTGCTGAGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024240
VALIDATED
GINS4 MISSION shRNA Lentiviral Transduction Particles
GINS complex subunit 4 (Sld5 homolog)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024240.3-1047s1c1
Sequence:CCGGCCTTCTCCTAAATTCCTGTTTCTCGAGAAACAGGAATTTAGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024240.3-1046s1c1
Sequence:CCGGGCCTTCTCCTAAATTCCTGTTCTCGAGAACAGGAATTTAGGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024240.3-369s1c1
Sequence:CCGGGAATGCGTCATGGAACAGCTTCTCGAGAAGCTGTTCCATGACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024240.5-472s1c1
Sequence:CCGGCTATGTCCTCAGCAGCTATTTCTCGAGAAATAGCTGCTGAGGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-711s21c1
Sequence:CCGGACCTAGATTCATACGTGTTTCCTCGAGGAAACACGTATGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-864s21c1
Sequence:CCGGCTGGAGCAGTTCAGCTAATATCTCGAGATATTAGCTGAACTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-783s21c1
Sequence:CCGGAGCAGAGAGACTACGTGATTGCTCGAGCAATCACGTAGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-993s21c1
Sequence:CCGGGGACCACTTGGACGTAGAAAGCTCGAGCTTTCTACGTCCAAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024240.5-473s21c1
Sequence:CCGGTATGTCCTCAGCAGCTATTTGCTCGAGCAAATAGCTGCTGAGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032336
VALIDATED
GINS4 MISSION shRNA Bacterial Glycerol Stock
GINS complex subunit 4 (Sld5 homolog)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-336s1c1
Sequence:CCGGGATTGTAGAATGTGTCATGGACTCGAGTCCATGACACATTCTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-477s1c1
Sequence:CCGGCCTCATGAAGATAGAGAAGTTCTCGAGAACTTCTCTATCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-408s1c1
Sequence:CCGGGAAGGTCAGCATCCACCAAATCTCGAGATTTGGTGGATGCTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-639s1c1
Sequence:CCGGCCCTAACTTACAGAAGGTGGACTCGAGTCCACCTTCTGTAAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-699s1c1
Sequence:CCGGCGTGTTTCTGAGAGTGAGAGACTCGAGTCTCTCACTCTCAGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032336.1-792s1c1
Sequence:CCGGCTCACAGCACTTGATCCGATACTCGAGTATCGGATCAAGTGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-423s1c1
Sequence:CCGGCCAAATGGAGATGGAGAGGATCTCGAGATCCTCTCCATCTCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032336.1-959s1c1
Sequence:CCGGCAACCGACCAACATGGTGAAACTCGAGTTTCACCATGTTGGTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-594s1c1
Sequence:CCGGGAACACAGAGTCCTATCTGAACTCGAGTTCAGATAGGACTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-326s1c1
Sequence:CCGGGCAAGCCTGAGATTGTAGAATCTCGAGATTCTACAATCTCAGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-615s21c1
Sequence:CCGGGAACACAGAGTCCTATCTGAACTCGAGTTCAGATAGGACTCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-813s21c1
Sequence:CCGGCTCACAGCACTTGATCCGATACTCGAGTATCGGATCAAGTGCTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-429s21c1
Sequence:CCGGGAAGGTCAGCATCCACCAAATCTCGAGATTTGGTGGATGCTGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-347s21c1
Sequence:CCGGGCAAGCCTGAGATTGTAGAATCTCGAGATTCTACAATCTCAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-498s21c1
Sequence:CCGGCCTCATGAAGATAGAGAAGTTCTCGAGAACTTCTCTATCTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032336
VALIDATED
GINS4 MISSION shRNA shRNA Plasmid DNA
GINS complex subunit 4 (Sld5 homolog)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-336s1c1
Sequence:CCGGGATTGTAGAATGTGTCATGGACTCGAGTCCATGACACATTCTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-477s1c1
Sequence:CCGGCCTCATGAAGATAGAGAAGTTCTCGAGAACTTCTCTATCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-408s1c1
Sequence:CCGGGAAGGTCAGCATCCACCAAATCTCGAGATTTGGTGGATGCTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-639s1c1
Sequence:CCGGCCCTAACTTACAGAAGGTGGACTCGAGTCCACCTTCTGTAAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-699s1c1
Sequence:CCGGCGTGTTTCTGAGAGTGAGAGACTCGAGTCTCTCACTCTCAGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032336.1-792s1c1
Sequence:CCGGCTCACAGCACTTGATCCGATACTCGAGTATCGGATCAAGTGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-423s1c1
Sequence:CCGGCCAAATGGAGATGGAGAGGATCTCGAGATCCTCTCCATCTCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032336.1-959s1c1
Sequence:CCGGCAACCGACCAACATGGTGAAACTCGAGTTTCACCATGTTGGTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-594s1c1
Sequence:CCGGGAACACAGAGTCCTATCTGAACTCGAGTTCAGATAGGACTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-326s1c1
Sequence:CCGGGCAAGCCTGAGATTGTAGAATCTCGAGATTCTACAATCTCAGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-615s21c1
Sequence:CCGGGAACACAGAGTCCTATCTGAACTCGAGTTCAGATAGGACTCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-813s21c1
Sequence:CCGGCTCACAGCACTTGATCCGATACTCGAGTATCGGATCAAGTGCTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-429s21c1
Sequence:CCGGGAAGGTCAGCATCCACCAAATCTCGAGATTTGGTGGATGCTGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-347s21c1
Sequence:CCGGGCAAGCCTGAGATTGTAGAATCTCGAGATTCTACAATCTCAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-498s21c1
Sequence:CCGGCCTCATGAAGATAGAGAAGTTCTCGAGAACTTCTCTATCTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032336
VALIDATED
GINS4 MISSION shRNA Lentiviral Transduction Particles
GINS complex subunit 4 (Sld5 homolog)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-336s1c1
Sequence:CCGGGATTGTAGAATGTGTCATGGACTCGAGTCCATGACACATTCTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-477s1c1
Sequence:CCGGCCTCATGAAGATAGAGAAGTTCTCGAGAACTTCTCTATCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-408s1c1
Sequence:CCGGGAAGGTCAGCATCCACCAAATCTCGAGATTTGGTGGATGCTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-639s1c1
Sequence:CCGGCCCTAACTTACAGAAGGTGGACTCGAGTCCACCTTCTGTAAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032336.1-699s1c1
Sequence:CCGGCGTGTTTCTGAGAGTGAGAGACTCGAGTCTCTCACTCTCAGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032336.1-792s1c1
Sequence:CCGGCTCACAGCACTTGATCCGATACTCGAGTATCGGATCAAGTGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-423s1c1
Sequence:CCGGCCAAATGGAGATGGAGAGGATCTCGAGATCCTCTCCATCTCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032336.1-959s1c1
Sequence:CCGGCAACCGACCAACATGGTGAAACTCGAGTTTCACCATGTTGGTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-594s1c1
Sequence:CCGGGAACACAGAGTCCTATCTGAACTCGAGTTCAGATAGGACTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032336.1-326s1c1
Sequence:CCGGGCAAGCCTGAGATTGTAGAATCTCGAGATTCTACAATCTCAGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-615s21c1
Sequence:CCGGGAACACAGAGTCCTATCTGAACTCGAGTTCAGATAGGACTCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-813s21c1
Sequence:CCGGCTCACAGCACTTGATCCGATACTCGAGTATCGGATCAAGTGCTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-429s21c1
Sequence:CCGGGAAGGTCAGCATCCACCAAATCTCGAGATTTGGTGGATGCTGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-347s21c1
Sequence:CCGGGCAAGCCTGAGATTGTAGAATCTCGAGATTCTACAATCTCAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032336.2-498s21c1
Sequence:CCGGCCTCATGAAGATAGAGAAGTTCTCGAGAACTTCTCTATCTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks