EMAIL THIS PAGE TO A FRIEND

GIP

gastric inhibitory polypeptide

UniProtKB ID: P09681, Q4VB42, Q6NTD3
Gene ID:
Human(2695) Summary: This gene encodes an incretin hormone and belongs to the glucagon superfamily. The encoded protein is important in maintaining glucose homeostasis as it is a potent stimulator of insulin secretion from pancreatic beta-cells following food ingestion and nutrient absorption. This gene stimulates insulin secretion via its G protein-coupled receptor activation of adenylyl cyclase and other signal transduction pathways. It is a relatively poor inhibitor of gastric acid secretion. [provided by RefSeq, Jul 2008]
Mouse(14607) gastric inhibitory polypeptide
Rat(25040) gastric inhibitory polypeptide
naked mole-rat(101707057) gastric inhibitory polypeptide
sheep(101113509) gastric inhibitory polypeptide
Zebrafish(790901) gastric inhibitory polypeptide
cow(511073) gastric inhibitory polypeptide
domestic cat(101080591) gastric inhibitory polypeptide
dog(609020) gastric inhibitory polypeptide
chicken(419989) gastric inhibitory polypeptide
fruit fly(31960) GIP-like
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004123 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004123 Rosetta Predictions human pricing
NM_019630 Rosetta Predictions rat pricing
NM_008119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041308 predicted 242
2 SASI_Hs01_00041309 predicted 481
3 SASI_Hs01_00041310 predicted 259
4 SASI_Hs01_00041311 predicted 261
5 SASI_Hs01_00041313 predicted 281
6 SASI_Hs02_00336972 predicted 221
7 SASI_Hs01_00041314 predicted 304
8 SASI_Hs01_00041315 predicted 292
9 SASI_Hs01_00041316 predicted 289
10 SASI_Hs02_00336973 predicted 276
11 SASI_Hs01_00041307 predicted 400
12 SASI_Hs01_00041312 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118096 predicted 306
2 SASI_Rn01_00118097 predicted 222
3 SASI_Rn01_00118099 predicted 224
4 SASI_Rn01_00118100 predicted 220
5 SASI_Rn01_00118101 predicted 213
6 SASI_Rn01_00118102 predicted 305
7 SASI_Rn01_00118103 predicted 218
8 SASI_Rn01_00118104 predicted 320
9 SASI_Rn01_00118105 predicted 367
10 SASI_Rn02_00262440 predicted 325
11 SASI_Rn01_00118098 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192788 predicted 408
2 SASI_Mm01_00192790 predicted 319
3 SASI_Mm01_00192791 predicted 198
4 SASI_Mm01_00192792 predicted 396
5 SASI_Mm01_00192793 predicted 367
6 SASI_Mm01_00192794 predicted 204
7 SASI_Mm01_00192795 predicted 281
8 SASI_Mm01_00192796 predicted 274
9 SASI_Mm02_00313182 predicted 383
10 SASI_Mm01_00192797 predicted 267
11 SASI_Mm01_00192789 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008119
GIP MISSION shRNA Bacterial Glycerol Stock
gastric inhibitory polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-461s21c1
Sequence:CCGGTGAGAGACCTTCTGATTCAAGCTCGAGCTTGAATCAGAAGGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-270s21c1
Sequence:CCGGCATGGACAAGATCCGACAACACTCGAGTGTTGTCGGATCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-241s21c1
Sequence:CCGGGGGACTTTCATCAGTGATTACCTCGAGGTAATCACTGATGAAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-184s21c1
Sequence:CCGGTTCCGATCCCATGCTAAATTTCTCGAGAAATTTAGCATGGGATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-411s21c1
Sequence:CCGGAGAGGCACAGGAGAGCTCTTTCTCGAGAAAGAGCTCTCCTGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-327s1c1
Sequence:CCGGGAAGAGTGACTGGAAACACAACTCGAGTTGTGTTTCCAGTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-282s1c1
Sequence:CCGGCCGACAACAAGACTTCGTGAACTCGAGTTCACGAAGTCTTGTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-252s1c1
Sequence:CCGGCAGTGATTACAGCATCGCCATCTCGAGATGGCGATGCTGTAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008119
GIP MISSION shRNA shRNA Plasmid DNA
gastric inhibitory polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-461s21c1
Sequence:CCGGTGAGAGACCTTCTGATTCAAGCTCGAGCTTGAATCAGAAGGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-270s21c1
Sequence:CCGGCATGGACAAGATCCGACAACACTCGAGTGTTGTCGGATCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-241s21c1
Sequence:CCGGGGGACTTTCATCAGTGATTACCTCGAGGTAATCACTGATGAAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-184s21c1
Sequence:CCGGTTCCGATCCCATGCTAAATTTCTCGAGAAATTTAGCATGGGATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-411s21c1
Sequence:CCGGAGAGGCACAGGAGAGCTCTTTCTCGAGAAAGAGCTCTCCTGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-327s1c1
Sequence:CCGGGAAGAGTGACTGGAAACACAACTCGAGTTGTGTTTCCAGTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-282s1c1
Sequence:CCGGCCGACAACAAGACTTCGTGAACTCGAGTTCACGAAGTCTTGTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-252s1c1
Sequence:CCGGCAGTGATTACAGCATCGCCATCTCGAGATGGCGATGCTGTAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008119
GIP MISSION shRNA Lentiviral Transduction Particles
gastric inhibitory polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-461s21c1
Sequence:CCGGTGAGAGACCTTCTGATTCAAGCTCGAGCTTGAATCAGAAGGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-270s21c1
Sequence:CCGGCATGGACAAGATCCGACAACACTCGAGTGTTGTCGGATCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-241s21c1
Sequence:CCGGGGGACTTTCATCAGTGATTACCTCGAGGTAATCACTGATGAAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-184s21c1
Sequence:CCGGTTCCGATCCCATGCTAAATTTCTCGAGAAATTTAGCATGGGATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008119.2-411s21c1
Sequence:CCGGAGAGGCACAGGAGAGCTCTTTCTCGAGAAAGAGCTCTCCTGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-327s1c1
Sequence:CCGGGAAGAGTGACTGGAAACACAACTCGAGTTGTGTTTCCAGTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-282s1c1
Sequence:CCGGCCGACAACAAGACTTCGTGAACTCGAGTTCACGAAGTCTTGTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008119.2-252s1c1
Sequence:CCGGCAGTGATTACAGCATCGCCATCTCGAGATGGCGATGCTGTAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004123
GIP MISSION shRNA Bacterial Glycerol Stock
gastric inhibitory polypeptide
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-309s1c1
Sequence:CCGGCAAGACTTTGTGAACTGGCTGCTCGAGCAGCCAGTTCACAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-350s1c1
Sequence:CCGGGAATGACTGGAAACACAACATCTCGAGATGTTGTGTTTCCAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-281s1c1
Sequence:CCGGCAGTATTGCCATGGACAAGATCTCGAGATCTTGTCCATGGCAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-272s1c1
Sequence:CCGGCAGTGACTACAGTATTGCCATCTCGAGATGGCAATACTGTAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-491s1c1
Sequence:CCGGCTTGCTGATTCAAGAGCTGTTCTCGAGAACAGCTCTTGAATCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-404s1c1
Sequence:CCGGCAGTCAAGCTAATAGGAAGGACTCGAGTCCTTCCTATTAGCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-518s1c1
Sequence:CCGGCTTGCTGGATCAGACAAACCTCTCGAGAGGTTTGTCTGATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-515s1c1
Sequence:CCGGCTGCTTGCTGGATCAGACAAACTCGAGTTTGTCTGATCCAGCAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-402s1c1
Sequence:CCGGGCCAGTCAAGCTAATAGGAAGCTCGAGCTTCCTATTAGCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-200s1c1
Sequence:CCGGGCCTGTTGGATCTCATGCTAACTCGAGTTAGCATGAGATCCAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-288s1c1
Sequence:CCGGGCCATGGACAAGATTCACCAACTCGAGTTGGTGAATCTTGTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004123
GIP MISSION shRNA shRNA Plasmid DNA
gastric inhibitory polypeptide
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-309s1c1
Sequence:CCGGCAAGACTTTGTGAACTGGCTGCTCGAGCAGCCAGTTCACAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-350s1c1
Sequence:CCGGGAATGACTGGAAACACAACATCTCGAGATGTTGTGTTTCCAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-281s1c1
Sequence:CCGGCAGTATTGCCATGGACAAGATCTCGAGATCTTGTCCATGGCAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-272s1c1
Sequence:CCGGCAGTGACTACAGTATTGCCATCTCGAGATGGCAATACTGTAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-491s1c1
Sequence:CCGGCTTGCTGATTCAAGAGCTGTTCTCGAGAACAGCTCTTGAATCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-404s1c1
Sequence:CCGGCAGTCAAGCTAATAGGAAGGACTCGAGTCCTTCCTATTAGCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-518s1c1
Sequence:CCGGCTTGCTGGATCAGACAAACCTCTCGAGAGGTTTGTCTGATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-515s1c1
Sequence:CCGGCTGCTTGCTGGATCAGACAAACTCGAGTTTGTCTGATCCAGCAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-402s1c1
Sequence:CCGGGCCAGTCAAGCTAATAGGAAGCTCGAGCTTCCTATTAGCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-200s1c1
Sequence:CCGGGCCTGTTGGATCTCATGCTAACTCGAGTTAGCATGAGATCCAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-288s1c1
Sequence:CCGGGCCATGGACAAGATTCACCAACTCGAGTTGGTGAATCTTGTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004123
GIP MISSION shRNA Lentiviral Transduction Particles
gastric inhibitory polypeptide
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-309s1c1
Sequence:CCGGCAAGACTTTGTGAACTGGCTGCTCGAGCAGCCAGTTCACAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-350s1c1
Sequence:CCGGGAATGACTGGAAACACAACATCTCGAGATGTTGTGTTTCCAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-281s1c1
Sequence:CCGGCAGTATTGCCATGGACAAGATCTCGAGATCTTGTCCATGGCAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-272s1c1
Sequence:CCGGCAGTGACTACAGTATTGCCATCTCGAGATGGCAATACTGTAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-491s1c1
Sequence:CCGGCTTGCTGATTCAAGAGCTGTTCTCGAGAACAGCTCTTGAATCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-404s1c1
Sequence:CCGGCAGTCAAGCTAATAGGAAGGACTCGAGTCCTTCCTATTAGCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-518s1c1
Sequence:CCGGCTTGCTGGATCAGACAAACCTCTCGAGAGGTTTGTCTGATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-515s1c1
Sequence:CCGGCTGCTTGCTGGATCAGACAAACTCGAGTTTGTCTGATCCAGCAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-402s1c1
Sequence:CCGGGCCAGTCAAGCTAATAGGAAGCTCGAGCTTCCTATTAGCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004123.1-200s1c1
Sequence:CCGGGCCTGTTGGATCTCATGCTAACTCGAGTTAGCATGAGATCCAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004123.1-288s1c1
Sequence:CCGGGCCATGGACAAGATTCACCAACTCGAGTTGGTGAATCTTGTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks