EMAIL THIS PAGE TO A FRIEND

GIPC1

GIPC PDZ domain containing family, member 1

154 Gene Product Result for
Synonyms: C19orf3 GIPC GLUT1CBP Hs.6454 IIP-1 NIP RGS19IP1 SEMCAP SYNECTIIN SYNECTIN TIP-2
UniProtKB ID: O14908, A8K4I3, A8MZG3, Q9BTC9
Gene ID:
Human(10755) Summary: GIPC1 is a scaffolding protein that regulates cell surface receptor expression and trafficking (Lee et al., 2008 [PubMed 18775991]
Mouse(67903) GIPC PDZ domain containing family, member 1
Rat(83823) GIPC PDZ domain containing family, member 1
Zebrafish(445568) GIPC PDZ domain containing family, member 1
cow(519617) GIPC PDZ domain containing family, member 1
domestic cat(101092338) GIPC PDZ domain containing family, member 1
dog(484902) GIPC PDZ domain containing family, member 1
sheep(101122352) GIPC PDZ domain containing family, member 1
domestic guinea pig(100713509) GIPC PDZ domain containing family, member 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005716 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072801 MISSION® esiRNA esiRNA human GIPC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005716 Rosetta Predictions human pricing
NM_202467 Rosetta Predictions human pricing
NM_202468 Rosetta Predictions human pricing
NM_202469 Rosetta Predictions human pricing
NM_202470 Rosetta Predictions human pricing
NM_202494 Rosetta Predictions human pricing
NM_053341 Rosetta Predictions rat pricing
NM_018771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154051 predicted 903
2 SASI_Hs01_00154052 predicted 1187
3 SASI_Hs01_00154053 predicted 1203
4 SASI_Hs01_00154054 predicted 916
5 SASI_Hs01_00154055 predicted 1628
6 SASI_Hs01_00154056 predicted 915
7 SASI_Hs01_00154057 predicted 1057
8 SASI_Hs01_00154058 predicted 1577
9 SASI_Hs01_00154059 predicted 1079
10 SASI_Hs01_00154060 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238035 predicted 589
2 SASI_Hs01_00238036 predicted 875
3 SASI_Hs01_00238037 predicted 885
4 SASI_Hs01_00238038 predicted 593
5 SASI_Hs01_00238039 predicted 1318
6 SASI_Hs01_00238040 predicted 597
7 SASI_Hs01_00238041 predicted 734
8 SASI_Hs01_00238042 predicted 1259
9 SASI_Hs01_00238043 predicted 762
10 SASI_Hs01_00238044 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103257 predicted 851
2 SASI_Hs01_00103258 predicted 1134
3 SASI_Hs01_00103259 predicted 1152
4 SASI_Hs01_00103260 predicted 863
5 SASI_Hs01_00103261 predicted 1578
6 SASI_Hs01_00103262 predicted 868
7 SASI_Hs01_00103263 predicted 1001
8 SASI_Hs01_00103264 predicted 1528
9 SASI_Hs01_00103265 predicted 1027
10 SASI_Hs01_00103266 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052688 predicted 528
2 SASI_Hs01_00052689 predicted 821
3 SASI_Hs01_00052690 predicted 834
4 SASI_Hs01_00052691 predicted 542
5 SASI_Hs01_00052692 predicted 1262
6 SASI_Hs01_00052693 predicted 543
7 SASI_Hs01_00052694 predicted 686
8 SASI_Hs01_00052695 predicted 1210
9 SASI_Hs01_00052696 predicted 706
10 SASI_Hs01_00052697 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189608 predicted 765
2 SASI_Hs01_00189609 predicted 1050
3 SASI_Hs01_00189610 predicted 1066
4 SASI_Hs01_00189611 predicted 768
5 SASI_Hs01_00189612 predicted 1484
6 SASI_Hs01_00189613 predicted 779
7 SASI_Hs01_00189614 predicted 908
8 SASI_Hs01_00189615 predicted 1440
9 SASI_Hs01_00189616 predicted 933
10 SASI_Hs01_00189617 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234468 predicted 443
2 SASI_Hs01_00234469 predicted 731
3 SASI_Hs01_00234470 predicted 745
4 SASI_Hs01_00234471 predicted 450
5 SASI_Hs01_00234472 predicted 1166
6 SASI_Hs01_00234473 predicted 461
7 SASI_Hs01_00234474 predicted 594
8 SASI_Hs01_00234475 predicted 1116
9 SASI_Hs01_00234476 predicted 616
10 SASI_Hs01_00234477 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045914 predicted 436
2 SASI_Rn02_00265797 predicted 1130
3 SASI_Rn01_00045916 predicted 660
4 SASI_Rn01_00045917 predicted 264
5 SASI_Rn01_00045918 predicted 334
6 SASI_Rn01_00045919 predicted 1031
7 SASI_Rn01_00045920 predicted 697
8 SASI_Rn01_00045921 predicted 1120
9 SASI_Rn01_00045922 predicted 627
10 SASI_Rn01_00045923 predicted 408
11 SASI_Rn01_00045915 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153260 predicted 727
2 SASI_Mm01_00153261 predicted 1034
3 SASI_Mm01_00153262 predicted 1070
4 SASI_Mm01_00153263 predicted 1019
5 SASI_Mm01_00153264 predicted 303
6 SASI_Mm01_00153265 predicted 382
7 SASI_Mm01_00153266 predicted 1175
8 SASI_Mm01_00153267 predicted 702
9 SASI_Mm02_00324083 predicted 405
10 SASI_Mm01_00153268 predicted 584
11 SASI_Mm01_00153259 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018771
VALIDATED
GIPC1 MISSION shRNA Bacterial Glycerol Stock
GIPC PDZ domain containing family, member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018771.3-556s1c1
Sequence:CCGGCGCCTTCATTAAGCGCATCAACTCGAGTTGATGCGCTTAATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-1034s1c1
Sequence:CCGGCCAGATGAATTTGTCTTTGATCTCGAGATCAAAGACAAATTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018771.3-1024s1c1
Sequence:CCGGCTTCGCATTCCCAGATGAATTCTCGAGAATTCATCTGGGAATGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-731s1c1
Sequence:CCGGGAACCTCGAAAGGCCTTTGATCTCGAGATCAAAGGCCTTTCGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-322s1c1
Sequence:CCGGCACTAATGTCAAGGAGCTGTACTCGAGTACAGCTCCTTGACATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-322s21c1
Sequence:CCGGCACTAATGTCAAGGAGCTGTACTCGAGTACAGCTCCTTGACATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-1024s21c1
Sequence:CCGGCTTCGCATTCCCAGATGAATTCTCGAGAATTCATCTGGGAATGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-731s21c1
Sequence:CCGGGAACCTCGAAAGGCCTTTGATCTCGAGATCAAAGGCCTTTCGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-556s21c1
Sequence:CCGGCGCCTTCATTAAGCGCATCAACTCGAGTTGATGCGCTTAATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018771
VALIDATED
GIPC1 MISSION shRNA shRNA Plasmid DNA
GIPC PDZ domain containing family, member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018771.3-556s1c1
Sequence:CCGGCGCCTTCATTAAGCGCATCAACTCGAGTTGATGCGCTTAATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-1034s1c1
Sequence:CCGGCCAGATGAATTTGTCTTTGATCTCGAGATCAAAGACAAATTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018771.3-1024s1c1
Sequence:CCGGCTTCGCATTCCCAGATGAATTCTCGAGAATTCATCTGGGAATGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-731s1c1
Sequence:CCGGGAACCTCGAAAGGCCTTTGATCTCGAGATCAAAGGCCTTTCGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-322s1c1
Sequence:CCGGCACTAATGTCAAGGAGCTGTACTCGAGTACAGCTCCTTGACATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-322s21c1
Sequence:CCGGCACTAATGTCAAGGAGCTGTACTCGAGTACAGCTCCTTGACATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-1024s21c1
Sequence:CCGGCTTCGCATTCCCAGATGAATTCTCGAGAATTCATCTGGGAATGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-731s21c1
Sequence:CCGGGAACCTCGAAAGGCCTTTGATCTCGAGATCAAAGGCCTTTCGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-556s21c1
Sequence:CCGGCGCCTTCATTAAGCGCATCAACTCGAGTTGATGCGCTTAATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018771
VALIDATED
GIPC1 MISSION shRNA Lentiviral Transduction Particles
GIPC PDZ domain containing family, member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018771.3-556s1c1
Sequence:CCGGCGCCTTCATTAAGCGCATCAACTCGAGTTGATGCGCTTAATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-1034s1c1
Sequence:CCGGCCAGATGAATTTGTCTTTGATCTCGAGATCAAAGACAAATTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018771.3-1024s1c1
Sequence:CCGGCTTCGCATTCCCAGATGAATTCTCGAGAATTCATCTGGGAATGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-731s1c1
Sequence:CCGGGAACCTCGAAAGGCCTTTGATCTCGAGATCAAAGGCCTTTCGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018771.3-322s1c1
Sequence:CCGGCACTAATGTCAAGGAGCTGTACTCGAGTACAGCTCCTTGACATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-322s21c1
Sequence:CCGGCACTAATGTCAAGGAGCTGTACTCGAGTACAGCTCCTTGACATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-1024s21c1
Sequence:CCGGCTTCGCATTCCCAGATGAATTCTCGAGAATTCATCTGGGAATGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-731s21c1
Sequence:CCGGGAACCTCGAAAGGCCTTTGATCTCGAGATCAAAGGCCTTTCGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018771.3-556s21c1
Sequence:CCGGCGCCTTCATTAAGCGCATCAACTCGAGTTGATGCGCTTAATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005716
VALIDATED
GIPC1 MISSION shRNA Bacterial Glycerol Stock
GIPC PDZ domain containing family, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1699s1c1
Sequence:CCGGGCAAATGCAATAATGCCCTCACTCGAGTGAGGGCATTATTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1083s1c1
Sequence:CCGGGCTGGAGAGTTACATGGGTATCTCGAGATACCCATGTAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005716.2-499s1c1
Sequence:CCGGACCAACGTCAAGGAGCTGTATCTCGAGATACAGCTCCTTGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005716.2-795s1c1
Sequence:CCGGCGACATGATCGAGGCCATTAACTCGAGTTAATGGCCTCGATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1045s1c1
Sequence:CCGGGCCTTTGAAGAGAAGGCCATTCTCGAGAATGGCCTTCTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1083s21c1
Sequence:CCGGGCTGGAGAGTTACATGGGTATCTCGAGATACCCATGTAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-499s21c1
Sequence:CCGGACCAACGTCAAGGAGCTGTATCTCGAGATACAGCTCCTTGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-795s21c1
Sequence:CCGGCGACATGATCGAGGCCATTAACTCGAGTTAATGGCCTCGATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1699s21c1
Sequence:CCGGGCAAATGCAATAATGCCCTCACTCGAGTGAGGGCATTATTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1045s21c1
Sequence:CCGGGCCTTTGAAGAGAAGGCCATTCTCGAGAATGGCCTTCTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005716
VALIDATED
GIPC1 MISSION shRNA shRNA Plasmid DNA
GIPC PDZ domain containing family, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1699s1c1
Sequence:CCGGGCAAATGCAATAATGCCCTCACTCGAGTGAGGGCATTATTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1083s1c1
Sequence:CCGGGCTGGAGAGTTACATGGGTATCTCGAGATACCCATGTAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005716.2-499s1c1
Sequence:CCGGACCAACGTCAAGGAGCTGTATCTCGAGATACAGCTCCTTGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005716.2-795s1c1
Sequence:CCGGCGACATGATCGAGGCCATTAACTCGAGTTAATGGCCTCGATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1045s1c1
Sequence:CCGGGCCTTTGAAGAGAAGGCCATTCTCGAGAATGGCCTTCTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1083s21c1
Sequence:CCGGGCTGGAGAGTTACATGGGTATCTCGAGATACCCATGTAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-499s21c1
Sequence:CCGGACCAACGTCAAGGAGCTGTATCTCGAGATACAGCTCCTTGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-795s21c1
Sequence:CCGGCGACATGATCGAGGCCATTAACTCGAGTTAATGGCCTCGATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1699s21c1
Sequence:CCGGGCAAATGCAATAATGCCCTCACTCGAGTGAGGGCATTATTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1045s21c1
Sequence:CCGGGCCTTTGAAGAGAAGGCCATTCTCGAGAATGGCCTTCTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005716
VALIDATED
GIPC1 MISSION shRNA Lentiviral Transduction Particles
GIPC PDZ domain containing family, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1699s1c1
Sequence:CCGGGCAAATGCAATAATGCCCTCACTCGAGTGAGGGCATTATTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1083s1c1
Sequence:CCGGGCTGGAGAGTTACATGGGTATCTCGAGATACCCATGTAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005716.2-499s1c1
Sequence:CCGGACCAACGTCAAGGAGCTGTATCTCGAGATACAGCTCCTTGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005716.2-795s1c1
Sequence:CCGGCGACATGATCGAGGCCATTAACTCGAGTTAATGGCCTCGATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005716.2-1045s1c1
Sequence:CCGGGCCTTTGAAGAGAAGGCCATTCTCGAGAATGGCCTTCTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1083s21c1
Sequence:CCGGGCTGGAGAGTTACATGGGTATCTCGAGATACCCATGTAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-499s21c1
Sequence:CCGGACCAACGTCAAGGAGCTGTATCTCGAGATACAGCTCCTTGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-795s21c1
Sequence:CCGGCGACATGATCGAGGCCATTAACTCGAGTTAATGGCCTCGATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1699s21c1
Sequence:CCGGGCAAATGCAATAATGCCCTCACTCGAGTGAGGGCATTATTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005716.2-1045s21c1
Sequence:CCGGGCCTTTGAAGAGAAGGCCATTCTCGAGAATGGCCTTCTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks