EMAIL THIS PAGE TO A FRIEND

GIPC2

GIPC PDZ domain containing family, member 2

Synonyms: SEMCAP-2 SEMCAP2
UniProtKB ID: Q8TF65, Q8IYD3, Q9NXS7
Gene ID:
Mouse(54120) GIPC PDZ domain containing family, member 2
Rat(365960) GIPC PDZ domain containing family, member 2
domestic guinea pig(100713056) GIPC PDZ domain containing family, member 2
naked mole-rat(101698927) GIPC PDZ domain containing family, member 2
sheep(101102349) GIPC PDZ domain containing family, member 2
Zebrafish(393904) GIPC PDZ domain containing family, member 2
chicken(424549) GIPC PDZ domain containing family, member 2
dog(490200) GIPC PDZ domain containing family, member 2
domestic cat(101093377) GIPC PDZ domain containing family, member 2
cow(518246) GIPC PDZ domain containing family, member 2
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017655 Rosetta Predictions human pricing
NM_001037210 Rosetta Predictions rat pricing
NM_016867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350362 predicted 774
2 SASI_Hs01_00114389 predicted 893
3 SASI_Hs01_00114390 predicted 436
4 SASI_Hs01_00114391 predicted 666
5 SASI_Hs01_00114392 predicted 511
6 SASI_Hs01_00114394 predicted 438
7 SASI_Hs01_00114396 predicted 558
8 SASI_Hs02_00350363 predicted 575
9 SASI_Hs01_00114397 predicted 483
10 SASI_Hs01_00114398 predicted 893
11 SASI_Hs01_00114393 predicted 731
12 SASI_Hs01_00114395 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107975 predicted 1034
2 SASI_Rn01_00107976 predicted 1030
3 SASI_Rn01_00107977 predicted 755
4 SASI_Rn01_00107978 predicted 404
5 SASI_Rn02_00204326 predicted 308
6 SASI_Rn01_00107980 predicted 909
7 SASI_Rn01_00107981 predicted 610
8 SASI_Rn01_00107982 predicted 396
9 SASI_Rn01_00107983 predicted 261
10 SASI_Rn01_00107984 predicted 644
11 SASI_Rn01_00107979 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096100 predicted 882
2 SASI_Mm02_00323657 predicted 311
3 SASI_Mm01_00096101 predicted 785
4 SASI_Mm01_00096102 predicted 920
5 SASI_Mm01_00096103 predicted 352
6 SASI_Mm01_00096104 predicted 543
7 SASI_Mm01_00096105 predicted 212
8 SASI_Mm01_00096106 predicted 838
9 SASI_Mm01_00096108 predicted 380
10 SASI_Mm01_00096109 predicted 1015
11 SASI_Mm01_00096107 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017655
GIPC2 MISSION shRNA Bacterial Glycerol Stock
GIPC PDZ domain containing family, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017655.4-1117s21c1
Sequence:CCGGTGCCAAACGAAGAGGATTATGCTCGAGCATAATCCTCTTCGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017655.4-1515s21c1
Sequence:CCGGACTAGGATTGGAGTATGATTTCTCGAGAAATCATACTCCAATCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-569s1c1
Sequence:CCGGCTTGGTCTCACCATTACAGATCTCGAGATCTGTAATGGTGAGACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-1115s1c1
Sequence:CCGGGATGCCAAACGAAGAGGATTACTCGAGTAATCCTCTTCGTTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-2497s1c1
Sequence:CCGGGCTGATATTCTTTGTCCGATTCTCGAGAATCGGACAAAGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-1691s1c1
Sequence:CCGGGCCAACTTTCTCTCTTTGTAACTCGAGTTACAAAGAGAGAAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-782s1c1
Sequence:CCGGCCTAAGAAGGCATTTGAAATACTCGAGTATTTCAAATGCCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-2405s1c1
Sequence:CCGGGCTGGATTATTGCTTAGATAACTCGAGTTATCTAAGCAATAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017655.4-1004s1c1
Sequence:CCGGGCTGGAAAGGACAAAGTAAATCTCGAGATTTACTTTGTCCTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-1739s1c1
Sequence:CCGGGCTTCTTTATACATGCTCTTACTCGAGTAAGAGCATGTATAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017655
GIPC2 MISSION shRNA shRNA Plasmid DNA
GIPC PDZ domain containing family, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017655.4-1117s21c1
Sequence:CCGGTGCCAAACGAAGAGGATTATGCTCGAGCATAATCCTCTTCGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017655.4-1515s21c1
Sequence:CCGGACTAGGATTGGAGTATGATTTCTCGAGAAATCATACTCCAATCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-569s1c1
Sequence:CCGGCTTGGTCTCACCATTACAGATCTCGAGATCTGTAATGGTGAGACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-1115s1c1
Sequence:CCGGGATGCCAAACGAAGAGGATTACTCGAGTAATCCTCTTCGTTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-2497s1c1
Sequence:CCGGGCTGATATTCTTTGTCCGATTCTCGAGAATCGGACAAAGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-1691s1c1
Sequence:CCGGGCCAACTTTCTCTCTTTGTAACTCGAGTTACAAAGAGAGAAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-782s1c1
Sequence:CCGGCCTAAGAAGGCATTTGAAATACTCGAGTATTTCAAATGCCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-2405s1c1
Sequence:CCGGGCTGGATTATTGCTTAGATAACTCGAGTTATCTAAGCAATAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017655.4-1004s1c1
Sequence:CCGGGCTGGAAAGGACAAAGTAAATCTCGAGATTTACTTTGTCCTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-1739s1c1
Sequence:CCGGGCTTCTTTATACATGCTCTTACTCGAGTAAGAGCATGTATAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017655
GIPC2 MISSION shRNA Lentiviral Transduction Particles
GIPC PDZ domain containing family, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017655.4-1117s21c1
Sequence:CCGGTGCCAAACGAAGAGGATTATGCTCGAGCATAATCCTCTTCGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017655.4-1515s21c1
Sequence:CCGGACTAGGATTGGAGTATGATTTCTCGAGAAATCATACTCCAATCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-569s1c1
Sequence:CCGGCTTGGTCTCACCATTACAGATCTCGAGATCTGTAATGGTGAGACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-1115s1c1
Sequence:CCGGGATGCCAAACGAAGAGGATTACTCGAGTAATCCTCTTCGTTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-2497s1c1
Sequence:CCGGGCTGATATTCTTTGTCCGATTCTCGAGAATCGGACAAAGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-1691s1c1
Sequence:CCGGGCCAACTTTCTCTCTTTGTAACTCGAGTTACAAAGAGAGAAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017655.4-782s1c1
Sequence:CCGGCCTAAGAAGGCATTTGAAATACTCGAGTATTTCAAATGCCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-2405s1c1
Sequence:CCGGGCTGGATTATTGCTTAGATAACTCGAGTTATCTAAGCAATAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017655.4-1004s1c1
Sequence:CCGGGCTGGAAAGGACAAAGTAAATCTCGAGATTTACTTTGTCCTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017655.4-1739s1c1
Sequence:CCGGGCTTCTTTATACATGCTCTTACTCGAGTAAGAGCATGTATAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016867
GIPC2 MISSION shRNA Bacterial Glycerol Stock
GIPC PDZ domain containing family, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-578s21c1
Sequence:CCGGGAGCTCTTTACTTTGCAGTTACTCGAGTAACTGCAAAGTAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016867.1-1025s21c1
Sequence:CCGGCACTGTTATGAACTCTACTTTCTCGAGAAAGTAGAGTTCATAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-532s21c1
Sequence:CCGGGCGTCACTTTGAAGTCGCTAACTCGAGTTAGCGACTTCAAAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-263s21c1
Sequence:CCGGTGTACCTTAAATACGCCTAAACTCGAGTTTAGGCGTATTTAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-749s21c1
Sequence:CCGGGCAATCGGAAAGGTTGATGATCTCGAGATCATCAACCTTTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016867.1-1025s1c1
Sequence:CCGGCACTGTTATGAACTCTACTTTCTCGAGAAAGTAGAGTTCATAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-749s1c1
Sequence:CCGGGCAATCGGAAAGGTTGATGATCTCGAGATCATCAACCTTTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-578s1c1
Sequence:CCGGGAGCTCTTTACTTTGCAGTTACTCGAGTAACTGCAAAGTAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-263s1c1
Sequence:CCGGTGTACCTTAAATACGCCTAAACTCGAGTTTAGGCGTATTTAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-532s1c1
Sequence:CCGGGCGTCACTTTGAAGTCGCTAACTCGAGTTAGCGACTTCAAAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016867
GIPC2 MISSION shRNA shRNA Plasmid DNA
GIPC PDZ domain containing family, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-578s21c1
Sequence:CCGGGAGCTCTTTACTTTGCAGTTACTCGAGTAACTGCAAAGTAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016867.1-1025s21c1
Sequence:CCGGCACTGTTATGAACTCTACTTTCTCGAGAAAGTAGAGTTCATAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-532s21c1
Sequence:CCGGGCGTCACTTTGAAGTCGCTAACTCGAGTTAGCGACTTCAAAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-263s21c1
Sequence:CCGGTGTACCTTAAATACGCCTAAACTCGAGTTTAGGCGTATTTAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-749s21c1
Sequence:CCGGGCAATCGGAAAGGTTGATGATCTCGAGATCATCAACCTTTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016867.1-1025s1c1
Sequence:CCGGCACTGTTATGAACTCTACTTTCTCGAGAAAGTAGAGTTCATAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-749s1c1
Sequence:CCGGGCAATCGGAAAGGTTGATGATCTCGAGATCATCAACCTTTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-578s1c1
Sequence:CCGGGAGCTCTTTACTTTGCAGTTACTCGAGTAACTGCAAAGTAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-263s1c1
Sequence:CCGGTGTACCTTAAATACGCCTAAACTCGAGTTTAGGCGTATTTAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-532s1c1
Sequence:CCGGGCGTCACTTTGAAGTCGCTAACTCGAGTTAGCGACTTCAAAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016867
GIPC2 MISSION shRNA Lentiviral Transduction Particles
GIPC PDZ domain containing family, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-578s21c1
Sequence:CCGGGAGCTCTTTACTTTGCAGTTACTCGAGTAACTGCAAAGTAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016867.1-1025s21c1
Sequence:CCGGCACTGTTATGAACTCTACTTTCTCGAGAAAGTAGAGTTCATAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-532s21c1
Sequence:CCGGGCGTCACTTTGAAGTCGCTAACTCGAGTTAGCGACTTCAAAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-263s21c1
Sequence:CCGGTGTACCTTAAATACGCCTAAACTCGAGTTTAGGCGTATTTAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016867.1-749s21c1
Sequence:CCGGGCAATCGGAAAGGTTGATGATCTCGAGATCATCAACCTTTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016867.1-1025s1c1
Sequence:CCGGCACTGTTATGAACTCTACTTTCTCGAGAAAGTAGAGTTCATAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-749s1c1
Sequence:CCGGGCAATCGGAAAGGTTGATGATCTCGAGATCATCAACCTTTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-578s1c1
Sequence:CCGGGAGCTCTTTACTTTGCAGTTACTCGAGTAACTGCAAAGTAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-263s1c1
Sequence:CCGGTGTACCTTAAATACGCCTAAACTCGAGTTTAGGCGTATTTAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016867.1-532s1c1
Sequence:CCGGGCGTCACTTTGAAGTCGCTAACTCGAGTTAGCGACTTCAAAGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks