EMAIL THIS PAGE TO A FRIEND

GIPC3

GIPC PDZ domain containing family, member 3

49 Gene Product Result for
Synonyms: C19orf64 DFNB15 DFNB72 DFNB95
UniProtKB ID: Q8TF64, O75227
Gene ID:
Human(126326) Summary: The protein encoded by this gene belongs to the GIPC family. Studies in mice suggest that this gene is required for postnatal maturation of the hair bundle and long-term survival of hair cells and spiral ganglion in the ear. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2011]
Mouse(209047) GIPC PDZ domain containing family, member 3
Rat(500789) GIPC PDZ domain containing family, member 3
cow(618265) GIPC PDZ domain containing family, member 3
domestic cat(101088817) GIPC PDZ domain containing family, member 3
dog(485057) GIPC PDZ domain containing family, member 3
sheep(101117930) GIPC PDZ domain containing family, member 3
naked mole-rat(101698594) GIPC PDZ domain containing family, member 3
domestic guinea pig(100717308) GIPC PDZ domain containing family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133261 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133261 Rosetta Predictions human pricing
NM_001109282 Rosetta Predictions rat pricing
NM_148951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015987 predicted 598
2 SASI_Hs01_00015988 predicted 601
3 SASI_Hs01_00015989 predicted 610
4 SASI_Hs01_00015990 predicted 627
5 SASI_Hs01_00015991 predicted 488
6 SASI_Hs01_00015992 predicted 437
7 SASI_Hs01_00015993 predicted 499
8 SASI_Hs01_00015994 predicted 611
9 SASI_Hs01_00015995 predicted 756
10 SASI_Hs01_00015996 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246884 predicted 319
2 SASI_Rn02_00246885 predicted 465
3 SASI_Rn02_00246886 predicted 516
4 SASI_Rn02_00246887 predicted 435
5 SASI_Rn02_00246888 predicted 432
6 SASI_Rn02_00246889 predicted 355
7 SASI_Rn02_00246890 predicted 716
8 SASI_Rn02_00246891 predicted 492
9 SASI_Rn02_00246892 predicted 544
10 SASI_Rn02_00246893 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189177 predicted 349
2 SASI_Mm01_00189178 predicted 463
3 SASI_Mm01_00189179 predicted 431
4 SASI_Mm01_00189180 predicted 422
5 SASI_Mm01_00189181 predicted 382
6 SASI_Mm02_00342776 predicted 433
7 SASI_Mm02_00342777 predicted 213
8 SASI_Mm01_00189184 predicted 512
9 SASI_Mm02_00342778 predicted 431
10 SASI_Mm02_00342779 predicted 716
11 SASI_Mm01_00189176 predicted 578
12 SASI_Mm01_00189182 predicted 214
13 SASI_Mm01_00189183 predicted 583
14 SASI_Mm01_00189185 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148951
GIPC3 MISSION shRNA Bacterial Glycerol Stock
GIPC PDZ domain containing family, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-439s1c1
Sequence:CCGGGCCATCAATGACCACTCTATTCTCGAGAATAGAGTGGTCATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-469s1c1
Sequence:CCGGCGGCACTACGAGGTGGCTAAACTCGAGTTTAGCCACCTCGTAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-211s1c1
Sequence:CCGGAGTCACAAAGTGGACATGCAACTCGAGTTGCATGTCCACTTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-387s1c1
Sequence:CCGGAGGCAGCATTATCAACCGGATCTCGAGATCCGGTTGATAATGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-189s1c1
Sequence:CCGGGATCCTATTCTGCACCCTCAACTCGAGTTGAGGGTGCAGAATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148951
GIPC3 MISSION shRNA shRNA Plasmid DNA
GIPC PDZ domain containing family, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-439s1c1
Sequence:CCGGGCCATCAATGACCACTCTATTCTCGAGAATAGAGTGGTCATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-469s1c1
Sequence:CCGGCGGCACTACGAGGTGGCTAAACTCGAGTTTAGCCACCTCGTAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-211s1c1
Sequence:CCGGAGTCACAAAGTGGACATGCAACTCGAGTTGCATGTCCACTTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-387s1c1
Sequence:CCGGAGGCAGCATTATCAACCGGATCTCGAGATCCGGTTGATAATGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-189s1c1
Sequence:CCGGGATCCTATTCTGCACCCTCAACTCGAGTTGAGGGTGCAGAATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148951
GIPC3 MISSION shRNA Lentiviral Transduction Particles
GIPC PDZ domain containing family, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-439s1c1
Sequence:CCGGGCCATCAATGACCACTCTATTCTCGAGAATAGAGTGGTCATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-469s1c1
Sequence:CCGGCGGCACTACGAGGTGGCTAAACTCGAGTTTAGCCACCTCGTAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-211s1c1
Sequence:CCGGAGTCACAAAGTGGACATGCAACTCGAGTTGCATGTCCACTTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-387s1c1
Sequence:CCGGAGGCAGCATTATCAACCGGATCTCGAGATCCGGTTGATAATGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148951.1-189s1c1
Sequence:CCGGGATCCTATTCTGCACCCTCAACTCGAGTTGAGGGTGCAGAATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133261
GIPC3 MISSION shRNA Bacterial Glycerol Stock
GIPC PDZ domain containing family, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-367s1c1
Sequence:CCGGGAGGTCACTAAGACAGAGGATCTCGAGATCCTCTGTCTTAGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-438s1c1
Sequence:CCGGGAGAATCAAGGAAGGCAGTATCTCGAGATACTGCCTTCCTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-276s1c1
Sequence:CCGGCCACAAAGTGGACATGCAGAACTCGAGTTCTGCATGTCCACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133261.1-279s1c1
Sequence:CCGGCAAAGTGGACATGCAGAAGCTCTCGAGAGCTTCTGCATGTCCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-444s1c1
Sequence:CCGGCAAGGAAGGCAGTATCATCAACTCGAGTTGATGATACTGCCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-372s1c1
Sequence:CCGGCACTAAGACAGAGGATGCTCTCTCGAGAGAGCATCCTCTGTCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133261
GIPC3 MISSION shRNA shRNA Plasmid DNA
GIPC PDZ domain containing family, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-367s1c1
Sequence:CCGGGAGGTCACTAAGACAGAGGATCTCGAGATCCTCTGTCTTAGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-438s1c1
Sequence:CCGGGAGAATCAAGGAAGGCAGTATCTCGAGATACTGCCTTCCTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-276s1c1
Sequence:CCGGCCACAAAGTGGACATGCAGAACTCGAGTTCTGCATGTCCACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133261.1-279s1c1
Sequence:CCGGCAAAGTGGACATGCAGAAGCTCTCGAGAGCTTCTGCATGTCCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-444s1c1
Sequence:CCGGCAAGGAAGGCAGTATCATCAACTCGAGTTGATGATACTGCCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-372s1c1
Sequence:CCGGCACTAAGACAGAGGATGCTCTCTCGAGAGAGCATCCTCTGTCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133261
GIPC3 MISSION shRNA Lentiviral Transduction Particles
GIPC PDZ domain containing family, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-367s1c1
Sequence:CCGGGAGGTCACTAAGACAGAGGATCTCGAGATCCTCTGTCTTAGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-438s1c1
Sequence:CCGGGAGAATCAAGGAAGGCAGTATCTCGAGATACTGCCTTCCTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-276s1c1
Sequence:CCGGCCACAAAGTGGACATGCAGAACTCGAGTTCTGCATGTCCACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133261.1-279s1c1
Sequence:CCGGCAAAGTGGACATGCAGAAGCTCTCGAGAGCTTCTGCATGTCCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-444s1c1
Sequence:CCGGCAAGGAAGGCAGTATCATCAACTCGAGTTGATGATACTGCCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133261.1-372s1c1
Sequence:CCGGCACTAAGACAGAGGATGCTCTCTCGAGAGAGCATCCTCTGTCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks