EMAIL THIS PAGE TO A FRIEND

GIPR

gastric inhibitory polypeptide receptor

Synonyms: PGQTL2
UniProtKB ID: P48546, Q14401, Q16400, Q52M04, Q9UPI1
Gene ID:
Human(2696) Summary: This gene encodes a G-protein coupled receptor for gastric inhibitory polypeptide (GIP), which was originally identified as an activity in gut extracts that inhibited gastric acid secretion and gastrin release, but subsequently was demonstrated to stimulate insulin release in the presence of elevated glucose. Mice lacking this gene exhibit higher blood glucose levels with impaired initial insulin response after oral glucose load. Defect in this gene thus may contribute to the pathogenesis of diabetes. [provided by RefSeq, Oct 2011]
Mouse(381853) gastric inhibitory polypeptide receptor
Rat(25024) gastric inhibitory polypeptide receptor
domestic guinea pig(100723242) gastric inhibitory polypeptide receptor
naked mole-rat(101719356) gastric inhibitory polypeptide receptor
sheep(101114380) gastric inhibitory polypeptide receptor
sheep(100170666) gastric inhibitory polypeptide receptor
chicken(425670) gastric inhibitory polypeptide receptor
domestic cat(101082451) gastric inhibitory polypeptide receptor
dog(484439) gastric inhibitory polypeptide receptor
cow(617879) gastric inhibitory polypeptide receptor
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000164 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000164 Rosetta Predictions human pricing
NM_012714 Rosetta Predictions rat pricing
NM_001080815 Rosetta Predictions mouse pricing
XM_355865 Rosetta Predictions mouse pricing
XM_884678 Rosetta Predictions mouse pricing
XM_895699 Rosetta Predictions mouse pricing
XM_895712 Rosetta Predictions mouse pricing
XM_895723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301991 predicted 1212
2 SASI_Hs01_00182272 predicted 431
3 SASI_Hs01_00182274 predicted 269
4 SASI_Hs01_00182275 predicted 803
5 SASI_Hs02_00301992 predicted 377
6 SASI_Hs01_00182276 predicted 301
7 SASI_Hs02_00301993 predicted 555
8 SASI_Hs01_00182277 predicted 483
9 SASI_Hs01_00182278 predicted 598
10 SASI_Hs01_00182279 predicted 276
11 SASI_Hs01_00182273 predicted 269
12 SASI_Hs01_00182280 predicted 924
13 SASI_Hs01_00182281 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035552 predicted 658
2 SASI_Rn01_00035553 predicted 1057
3 SASI_Rn01_00035554 predicted 327
4 SASI_Rn01_00035555 predicted 1269
5 SASI_Rn01_00035556 predicted 1512
6 SASI_Rn01_00035557 predicted 1074
7 SASI_Rn02_00260049 predicted 334
8 SASI_Rn01_00035558 predicted 670
9 SASI_Rn02_00260050 predicted 337
10 SASI_Rn02_00260051 predicted 813
11 SASI_Rn01_00035551 predicted 873
12 SASI_Rn01_00035559 predicted 810
13 SASI_Rn01_00035560 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293883 predicted 330
2 SASI_Mm02_00293884 predicted 1055
3 SASI_Mm02_00293885 predicted 987
4 SASI_Mm02_00293886 predicted 484
5 SASI_Mm02_00293887 predicted 664
6 SASI_Mm02_00293888 predicted 853
7 SASI_Mm02_00293889 predicted 615
8 SASI_Mm02_00293890 predicted 609
9 SASI_Mm02_00293891 predicted 882
10 SASI_Mm02_00293892 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271126 predicted 854
2 SASI_Mm01_00271127 predicted 858
3 SASI_Mm01_00271128 predicted 851
4 SASI_Mm01_00271129 predicted 774
5 SASI_Mm01_00271130 predicted 871
6 SASI_Mm01_00271131 predicted 841
7 SASI_Mm01_00271132 predicted 778
8 SASI_Mm01_00271133 predicted 768
9 SASI_Mm01_00271134 predicted 852
10 SASI_Mm01_00271135 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240840 predicted 334
2 SASI_Mm01_00240841 predicted 330
3 SASI_Mm01_00240842 predicted 440
4 SASI_Mm01_00240843 predicted 490
5 SASI_Mm01_00240844 predicted 668
6 SASI_Mm01_00240845 predicted 625
7 SASI_Mm01_00240846 predicted 616
8 SASI_Mm01_00240847 predicted 339
9 SASI_Mm01_00240848 predicted 704
10 SASI_Mm01_00240849 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223930 predicted 1419
2 SASI_Mm01_00223931 predicted 1589
3 SASI_Mm01_00223932 predicted 1583
4 SASI_Mm01_00223933 predicted 1318
5 SASI_Mm01_00223934 predicted 1383
6 SASI_Mm01_00223935 predicted 1565
7 SASI_Mm01_00223936 predicted 1334
8 SASI_Mm01_00223937 predicted 1535
9 SASI_Mm01_00223938 predicted 1553
10 SASI_Mm01_00223939 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231035 predicted 1316
2 SASI_Mm01_00231036 predicted 1598
3 SASI_Mm01_00231037 predicted 1098
4 SASI_Mm01_00231038 predicted 1098
5 SASI_Mm01_00231039 predicted 1601
6 SASI_Mm01_00231040 predicted 1084
7 SASI_Mm01_00231041 predicted 1053
8 SASI_Mm01_00231042 predicted 1507
9 SASI_Mm01_00231043 predicted 1568
10 SASI_Mm01_00231044 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280074 predicted 553
2 SASI_Mm01_00280075 predicted 845
3 SASI_Mm01_00280076 predicted 554
4 SASI_Mm01_00280077 predicted 839
5 SASI_Mm01_00280078 predicted 550
6 SASI_Mm01_00280079 predicted 796
7 SASI_Mm01_00280080 predicted 585
8 SASI_Mm01_00280081 predicted 745
9 SASI_Mm01_00280082 predicted 813
10 SASI_Mm01_00280083 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000164
GIPR MISSION shRNA Bacterial Glycerol Stock
gastric inhibitory polypeptide receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-965s1c1
Sequence:CCGGGCAACGAAGTCAAGGCCATTTCTCGAGAAATGGCCTTGACTTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000164.2-1872s1c1
Sequence:CCGGCCTTGGCTGGAGTAGAATTAACTCGAGTTAATTCTACTCCAGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-564s1c1
Sequence:CCGGCCTGCTCATCTTGAGTTTGTTCTCGAGAACAAACTCAAGATGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-588s1c1
Sequence:CCGGGCGGCTACATTGCACTAGAAACTCGAGTTTCTAGTGCAATGTAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-480s1c1
Sequence:CCGGTCTGGACCAAAGGCTCATCTTCTCGAGAAGATGAGCCTTTGGTCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000164.2-977s21c1
Sequence:CCGGAGGCCATTTGGTGGATTATACCTCGAGGTATAATCCACCAAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000164.2-1681s21c1
Sequence:CCGGACACGCTATGGAATGGTTATGCTCGAGCATAACCATTCCATAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000164.2-619s21c1
Sequence:CCGGATCAACCTGTTCACGTCTTTCCTCGAGGAAAGACGTGAACAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000164
GIPR MISSION shRNA shRNA Plasmid DNA
gastric inhibitory polypeptide receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-965s1c1
Sequence:CCGGGCAACGAAGTCAAGGCCATTTCTCGAGAAATGGCCTTGACTTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000164.2-1872s1c1
Sequence:CCGGCCTTGGCTGGAGTAGAATTAACTCGAGTTAATTCTACTCCAGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-564s1c1
Sequence:CCGGCCTGCTCATCTTGAGTTTGTTCTCGAGAACAAACTCAAGATGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-588s1c1
Sequence:CCGGGCGGCTACATTGCACTAGAAACTCGAGTTTCTAGTGCAATGTAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-480s1c1
Sequence:CCGGTCTGGACCAAAGGCTCATCTTCTCGAGAAGATGAGCCTTTGGTCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000164.2-977s21c1
Sequence:CCGGAGGCCATTTGGTGGATTATACCTCGAGGTATAATCCACCAAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000164.2-1681s21c1
Sequence:CCGGACACGCTATGGAATGGTTATGCTCGAGCATAACCATTCCATAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000164.2-619s21c1
Sequence:CCGGATCAACCTGTTCACGTCTTTCCTCGAGGAAAGACGTGAACAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000164
GIPR MISSION shRNA Lentiviral Transduction Particles
gastric inhibitory polypeptide receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-965s1c1
Sequence:CCGGGCAACGAAGTCAAGGCCATTTCTCGAGAAATGGCCTTGACTTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000164.2-1872s1c1
Sequence:CCGGCCTTGGCTGGAGTAGAATTAACTCGAGTTAATTCTACTCCAGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-564s1c1
Sequence:CCGGCCTGCTCATCTTGAGTTTGTTCTCGAGAACAAACTCAAGATGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-588s1c1
Sequence:CCGGGCGGCTACATTGCACTAGAAACTCGAGTTTCTAGTGCAATGTAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000164.2-480s1c1
Sequence:CCGGTCTGGACCAAAGGCTCATCTTCTCGAGAAGATGAGCCTTTGGTCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000164.2-977s21c1
Sequence:CCGGAGGCCATTTGGTGGATTATACCTCGAGGTATAATCCACCAAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000164.2-1681s21c1
Sequence:CCGGACACGCTATGGAATGGTTATGCTCGAGCATAACCATTCCATAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000164.2-619s21c1
Sequence:CCGGATCAACCTGTTCACGTCTTTCCTCGAGGAAAGACGTGAACAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080815
GIPR MISSION shRNA Bacterial Glycerol Stock
gastric inhibitory polypeptide receptor
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-645s21c1
Sequence:CCGGGGCTGCACTGCACTCGTAATTCTCGAGAATTACGAGTGCAGTGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-810s21c1
Sequence:CCGGCCCAGATCATGACCCAATATTCTCGAGAATATTGGGTCATGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-1050s21c1
Sequence:CCGGTTCGCACTCCCATCCTAATAACTCGAGTTATTAGGATGGGAGTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-1535s21c1
Sequence:GTACCGGGAAAGTTACTGCTAGGTAAAGCTCGAGCTTTACCTAGCAGTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-674s21c1
Sequence:CCGGATGAACCTGTTCACGTCTTTCCTCGAGGAAAGACGTGAACAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080815.1-1568s21c1
Sequence:CCGGCTGTACAGTTAGCATGTATTCCTCGAGGAATACATGCTAACTGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080815
GIPR MISSION shRNA shRNA Plasmid DNA
gastric inhibitory polypeptide receptor
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-645s21c1
Sequence:CCGGGGCTGCACTGCACTCGTAATTCTCGAGAATTACGAGTGCAGTGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-810s21c1
Sequence:CCGGCCCAGATCATGACCCAATATTCTCGAGAATATTGGGTCATGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-1050s21c1
Sequence:CCGGTTCGCACTCCCATCCTAATAACTCGAGTTATTAGGATGGGAGTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-1535s21c1
Sequence:GTACCGGGAAAGTTACTGCTAGGTAAAGCTCGAGCTTTACCTAGCAGTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-674s21c1
Sequence:CCGGATGAACCTGTTCACGTCTTTCCTCGAGGAAAGACGTGAACAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080815.1-1568s21c1
Sequence:CCGGCTGTACAGTTAGCATGTATTCCTCGAGGAATACATGCTAACTGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080815
GIPR MISSION shRNA Lentiviral Transduction Particles
gastric inhibitory polypeptide receptor
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-645s21c1
Sequence:CCGGGGCTGCACTGCACTCGTAATTCTCGAGAATTACGAGTGCAGTGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-810s21c1
Sequence:CCGGCCCAGATCATGACCCAATATTCTCGAGAATATTGGGTCATGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-1050s21c1
Sequence:CCGGTTCGCACTCCCATCCTAATAACTCGAGTTATTAGGATGGGAGTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-1535s21c1
Sequence:GTACCGGGAAAGTTACTGCTAGGTAAAGCTCGAGCTTTACCTAGCAGTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080815.1-674s21c1
Sequence:CCGGATGAACCTGTTCACGTCTTTCCTCGAGGAAAGACGTGAACAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080815.1-1568s21c1
Sequence:CCGGCTGTACAGTTAGCATGTATTCCTCGAGGAATACATGCTAACTGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks