EMAIL THIS PAGE TO A FRIEND

GIT1

G protein-coupled receptor kinase interacting ArfGAP 1

129 Gene Product Result for
UniProtKB ID: Q9Y2X7, B4DGU9, B4DSV3, Q86SS0, Q9BRJ4
Gene ID:
Mouse(216963) G protein-coupled receptor kinase-interactor 1
Rat(83709) G protein-coupled receptor kinase interacting ArfGAP 1
chicken(417584) G protein-coupled receptor kinase interactor 1
dog(491180) G protein-coupled receptor kinase interacting ArfGAP 1
domestic cat(101091912) G protein-coupled receptor kinase interacting ArfGAP 1
cow(515088) G protein-coupled receptor kinase interacting ArfGAP 1
sheep(101122040) G protein-coupled receptor kinase interacting ArfGAP 1
naked mole-rat(101699975) G protein-coupled receptor kinase interacting ArfGAP 1
domestic guinea pig(100723451) G protein-coupled receptor kinase interacting ArfGAP 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G0298 Anti-GIT1 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse
immunoprecipitation, western blot pricing
HPA004059 Anti-GIT1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
G0173 Anti-GIT1 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat
immunofluorescence, immunoprecipitation, western blot pricing
HPA004186 Anti-GIT1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB5200609 Monoclonal Anti-Git1 - Alkaline Phosphatase antibody produced in mouse clone S39B-8, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200610 Monoclonal Anti-Git1 - Apc antibody produced in mouse clone S39B-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200601 Monoclonal Anti-Git1 - Atto 390 antibody produced in mouse clone S39B-8, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200602 Monoclonal Anti-Git1 - Atto 488 antibody produced in mouse clone S39B-8, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200603 Monoclonal Anti-Git1 - Atto 565 antibody produced in mouse clone S39B-8, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200604 Monoclonal Anti-Git1 - Atto 594 antibody produced in mouse clone S39B-8, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200605 Monoclonal Anti-Git1 - Atto 633 antibody produced in mouse clone S39B-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200606 Monoclonal Anti-Git1 - Atto 655 antibody produced in mouse clone S39B-8, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200607 Monoclonal Anti-Git1 - Atto 680 antibody produced in mouse clone S39B-8, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200608 Monoclonal Anti-Git1 - Atto 700 antibody produced in mouse clone S39B-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200611 Monoclonal Anti-Git1 - Biotin antibody produced in mouse clone S39B-8, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200612 Monoclonal Anti-Git1 - Fitc antibody produced in mouse clone S39B-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200613 Monoclonal Anti-Git1 - Hrp antibody produced in mouse clone S39B-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200614 Monoclonal Anti-Git1 - Pe/Atto 594 antibody produced in mouse clone S39B-8, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200615 Monoclonal Anti-Git1 - Percp antibody produced in mouse clone S39B-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200616 Monoclonal Anti-Git1 - Rpe antibody produced in mouse clone S39B-8, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200617 Monoclonal Anti-Git1 - Streptavidin antibody produced in mouse clone S39B-8, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200600 Monoclonal Anti-Git1 antibody produced in mouse clone S39B-8, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014030 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085454 Rosetta Predictions human pricing
NM_014030 Rosetta Predictions human pricing
NM_031814 Rosetta Predictions rat pricing
NM_001004144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317765 predicted 689
2 SASI_Hs02_00317766 predicted 1246
3 SASI_Hs02_00317767 predicted 1360
4 SASI_Hs02_00317768 predicted 536
5 SASI_Hs02_00317769 predicted 1253
6 SASI_Hs02_00317770 predicted 2065
7 SASI_Hs02_00317771 predicted 2568
8 SASI_Hs02_00317772 predicted 1561
9 SASI_Hs02_00317773 predicted 546
10 SASI_Hs02_00317774 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345006 predicted 683
2 SASI_Hs01_00025837 predicted 1223
3 SASI_Hs02_00345007 predicted 1332
4 SASI_Hs02_00345008 predicted 535
5 SASI_Hs02_00345009 predicted 1229
6 SASI_Hs02_00345010 predicted 2034
7 SASI_Hs02_00345011 predicted 2533
8 SASI_Hs02_00345012 predicted 1529
9 SASI_Hs01_00025841 predicted 551
10 SASI_Hs02_00345013 predicted 1208
11 SASI_Hs01_00025838 predicted 1865
12 SASI_Hs01_00025839 predicted 2005
13 SASI_Hs01_00025840 predicted 523
14 SASI_Hs01_00025842 predicted 943
15 SASI_Hs01_00025843 predicted 1160
16 SASI_Hs01_00025844 predicted 875
17 SASI_Hs01_00025845 predicted 1544
18 SASI_Hs01_00025846 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035069 predicted 1962
2 SASI_Rn02_00265275 predicted 1049
3 SASI_Rn01_00035070 predicted 355
4 SASI_Rn01_00035073 predicted 765
5 SASI_Rn01_00035074 predicted 2073
6 SASI_Rn01_00035075 predicted 964
7 SASI_Rn02_00265276 predicted 522
8 SASI_Rn01_00035076 predicted 2036
9 SASI_Rn01_00035077 predicted 364
10 SASI_Rn01_00035078 predicted 1699
11 SASI_Rn01_00035071 predicted 1359
12 SASI_Rn01_00035072 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089015 predicted 475
2 SASI_Mm02_00286451 predicted 1176
3 SASI_Mm01_00089017 predicted 1164
4 SASI_Mm01_00089018 predicted 1982
5 SASI_Mm01_00089019 predicted 1179
6 SASI_Mm01_00089020 predicted 2187
7 SASI_Mm01_00089021 predicted 1178
8 SASI_Mm01_00089022 predicted 1193
9 SASI_Mm01_00089023 predicted 1214
10 SASI_Mm01_00089024 predicted 1196
11 SASI_Mm01_00089016 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014030
GIT1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase interacting ArfGAP 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014030.3-974s21c1
Sequence:CCGGAGCCTTGACTTATCCGAATTGCTCGAGCAATTCGGATAAGTCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014030.3-543s21c1
Sequence:CCGGAGTACCAGATGCTGGCATTTGCTCGAGCAAATGCCAGCATCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014030.2-2971s1c1
Sequence:CCGGGCTCTCCCTTTAATGCCATATCTCGAGATATGGCATTAAAGGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-929s1c1
Sequence:CCGGCGGATCACAAGAATGGGCATTCTCGAGAATGCCCATTCTTGTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-2231s1c1
Sequence:CCGGCCTGCTCAGAGAAGATCCATTCTCGAGAATGGATCTTCTCTGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-1234s1c1
Sequence:CCGGGCCACCTTGATCATCGACATTCTCGAGAATGTCGATGATCAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-1213s1c1
Sequence:CCGGCGCTTTAATGCCCGAGAGTTTCTCGAGAAACTCTCGGGCATTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014030
GIT1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase interacting ArfGAP 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014030.3-974s21c1
Sequence:CCGGAGCCTTGACTTATCCGAATTGCTCGAGCAATTCGGATAAGTCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014030.3-543s21c1
Sequence:CCGGAGTACCAGATGCTGGCATTTGCTCGAGCAAATGCCAGCATCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014030.2-2971s1c1
Sequence:CCGGGCTCTCCCTTTAATGCCATATCTCGAGATATGGCATTAAAGGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-929s1c1
Sequence:CCGGCGGATCACAAGAATGGGCATTCTCGAGAATGCCCATTCTTGTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-2231s1c1
Sequence:CCGGCCTGCTCAGAGAAGATCCATTCTCGAGAATGGATCTTCTCTGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-1234s1c1
Sequence:CCGGGCCACCTTGATCATCGACATTCTCGAGAATGTCGATGATCAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-1213s1c1
Sequence:CCGGCGCTTTAATGCCCGAGAGTTTCTCGAGAAACTCTCGGGCATTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014030
GIT1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase interacting ArfGAP 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014030.3-974s21c1
Sequence:CCGGAGCCTTGACTTATCCGAATTGCTCGAGCAATTCGGATAAGTCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014030.3-543s21c1
Sequence:CCGGAGTACCAGATGCTGGCATTTGCTCGAGCAAATGCCAGCATCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014030.2-2971s1c1
Sequence:CCGGGCTCTCCCTTTAATGCCATATCTCGAGATATGGCATTAAAGGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-929s1c1
Sequence:CCGGCGGATCACAAGAATGGGCATTCTCGAGAATGCCCATTCTTGTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-2231s1c1
Sequence:CCGGCCTGCTCAGAGAAGATCCATTCTCGAGAATGGATCTTCTCTGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-1234s1c1
Sequence:CCGGGCCACCTTGATCATCGACATTCTCGAGAATGTCGATGATCAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014030.2-1213s1c1
Sequence:CCGGCGCTTTAATGCCCGAGAGTTTCTCGAGAAACTCTCGGGCATTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004144
VALIDATED
GIT1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase interacting ArfGAP 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-888s21c1
Sequence:CCGGTGATCACAAGAATGGGCATTACTCGAGTAATGCCCATTCTTGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-1220s21c1
Sequence:CCGGCCACCTTGATCATCGACATTCCTCGAGGAATGTCGATGATCAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-2121s21c1
Sequence:CCGGCACCGAAGACGTCATCCTAAACTCGAGTTTAGGATGACGTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-3260s1c1
Sequence:CCGGCCTACTTGTATCCCTGTCCTACTCGAGTAGGACAGGGATACAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-825s1c1
Sequence:CCGGGCTAGTTGAGTGCCAGTATGACTCGAGTCATACTGGCACTCAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-1569s1c1
Sequence:CCGGGCAAAGGGAGATCCACAAATTCTCGAGAATTTGTGGATCTCCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004144.1-2207s1c1
Sequence:CCGGGCTTTGTACCCTGTTCAGAAACTCGAGTTTCTGAACAGGGTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004144.1-880s1c1
Sequence:CCGGCGAAAGCCTGATCACAAGAATCTCGAGATTCTTGTGATCAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004144
VALIDATED
GIT1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase interacting ArfGAP 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-888s21c1
Sequence:CCGGTGATCACAAGAATGGGCATTACTCGAGTAATGCCCATTCTTGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-1220s21c1
Sequence:CCGGCCACCTTGATCATCGACATTCCTCGAGGAATGTCGATGATCAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-2121s21c1
Sequence:CCGGCACCGAAGACGTCATCCTAAACTCGAGTTTAGGATGACGTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-3260s1c1
Sequence:CCGGCCTACTTGTATCCCTGTCCTACTCGAGTAGGACAGGGATACAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-825s1c1
Sequence:CCGGGCTAGTTGAGTGCCAGTATGACTCGAGTCATACTGGCACTCAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-1569s1c1
Sequence:CCGGGCAAAGGGAGATCCACAAATTCTCGAGAATTTGTGGATCTCCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004144.1-2207s1c1
Sequence:CCGGGCTTTGTACCCTGTTCAGAAACTCGAGTTTCTGAACAGGGTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004144.1-880s1c1
Sequence:CCGGCGAAAGCCTGATCACAAGAATCTCGAGATTCTTGTGATCAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004144
VALIDATED
GIT1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase interacting ArfGAP 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-888s21c1
Sequence:CCGGTGATCACAAGAATGGGCATTACTCGAGTAATGCCCATTCTTGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-1220s21c1
Sequence:CCGGCCACCTTGATCATCGACATTCCTCGAGGAATGTCGATGATCAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004144.1-2121s21c1
Sequence:CCGGCACCGAAGACGTCATCCTAAACTCGAGTTTAGGATGACGTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-3260s1c1
Sequence:CCGGCCTACTTGTATCCCTGTCCTACTCGAGTAGGACAGGGATACAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-825s1c1
Sequence:CCGGGCTAGTTGAGTGCCAGTATGACTCGAGTCATACTGGCACTCAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004144.1-1569s1c1
Sequence:CCGGGCAAAGGGAGATCCACAAATTCTCGAGAATTTGTGGATCTCCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004144.1-2207s1c1
Sequence:CCGGGCTTTGTACCCTGTTCAGAAACTCGAGTTTCTGAACAGGGTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004144.1-880s1c1
Sequence:CCGGCGAAAGCCTGATCACAAGAATCTCGAGATTCTTGTGATCAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks