EMAIL THIS PAGE TO A FRIEND

GIT2

G protein-coupled receptor kinase interacting ArfGAP 2

168 Gene Product Result for
Synonyms: CAT-2 CAT2
UniProtKB ID: Q14161, Q86U59, Q96CI2, Q9BV91, Q9Y5V2
Gene ID:
Human(9815) Summary: This gene encodes a member of the GIT protein family, which interact with G protein-coupled receptor kinases and possess ADP-ribosylation factor (ARF) GTPase-activating protein (GAP) activity. GIT proteins traffic between cytoplasmic complexes, focal adhesions, and the cell periphery, and interact with Pak interacting exchange factor beta (PIX) to form large oligomeric complexes that transiently recruit other proteins. GIT proteins regulate cytoskeletal dynamics and participate in receptor internalization and membrane trafficking. This gene has been shown to repress lamellipodial extension and focal adhesion turnover, and is thought to regulate cell motility. This gene undergoes extensive alternative splicing to generate multiple isoforms, but the full-length nature of some of these variants has not been determined. The various isoforms have functional differences, with respect to ARF GAP activity and to G protein-coupled receptor kinase 2 binding. [provided by RefSeq, Sep 2008]
Mouse(26431) G protein-coupled receptor kinase-interactor 2
Rat(304546) G protein-coupled receptor kinase interacting ArfGAP 2
domestic guinea pig(100727065) G protein-coupled receptor kinase interacting ArfGAP 2
naked mole-rat(101702496) G protein-coupled receptor kinase interacting ArfGAP 2
sheep(101121803) G protein-coupled receptor kinase interacting ArfGAP 2
Domestic Rabbit(100348106) G protein-coupled receptor kinase interacting ArfGAP 2
chicken(374035) G protein-coupled receptor kinase interactor 2
dog(477520) G protein-coupled receptor kinase interacting ArfGAP 2
domestic cat(101093054) G protein-coupled receptor kinase interacting ArfGAP 2
cow(516048) G protein-coupled receptor kinase interacting ArfGAP 2
Horse(100066470) G protein-coupled receptor kinase interacting ArfGAP 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014776 Rosetta Predictions human pricing
NM_057169 Rosetta Predictions human pricing
NM_057170 Rosetta Predictions human pricing
NM_139201 Rosetta Predictions human pricing
NM_001005553 Rosetta Predictions rat pricing
NM_001077359 Rosetta Predictions mouse pricing
NM_001077360 Rosetta Predictions mouse pricing
NM_019834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153033 predicted 311
2 SASI_Hs01_00153034 predicted 444
3 SASI_Hs02_00346269 predicted 234
4 SASI_Hs02_00346270 predicted 507
5 SASI_Hs01_00153035 predicted 616
6 SASI_Hs01_00153036 predicted 289
7 SASI_Hs01_00153037 predicted 331
8 SASI_Hs01_00153040 predicted 339
9 SASI_Hs01_00153041 predicted 673
10 SASI_Hs01_00153042 predicted 281
11 SASI_Hs01_00153038 predicted 208
12 SASI_Hs01_00153039 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211728 predicted 313
2 SASI_Hs01_00211729 predicted 450
3 SASI_Hs01_00211730 predicted 239
4 SASI_Hs02_00362032 predicted 507
5 SASI_Hs01_00211732 predicted 287
6 SASI_Hs01_00211733 predicted 322
7 SASI_Hs02_00362033 predicted 589
8 SASI_Hs01_00211735 predicted 335
9 SASI_Hs01_00211736 predicted 676
10 SASI_Hs01_00211737 predicted 280
11 SASI_Hs01_00211731 predicted 616
12 SASI_Hs01_00211734 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065050 predicted 320
2 SASI_Hs01_00065051 predicted 448
3 SASI_Hs02_00362034 predicted 237
4 SASI_Hs02_00362035 predicted 508
5 SASI_Hs01_00065053 predicted 284
6 SASI_Hs01_00065054 predicted 326
7 SASI_Hs02_00362036 predicted 589
8 SASI_Hs01_00065057 predicted 331
9 SASI_Hs01_00065058 predicted 671
10 SASI_Hs01_00065059 predicted 273
11 SASI_Hs01_00065052 predicted 616
12 SASI_Hs01_00065055 predicted 214
13 SASI_Hs01_00065056 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245102 predicted 319
2 SASI_Hs01_00245103 predicted 443
3 SASI_Hs02_00364227 predicted 231
4 SASI_Hs02_00364228 predicted 509
5 SASI_Hs01_00245105 predicted 287
6 SASI_Hs01_00245106 predicted 326
7 SASI_Hs02_00364229 predicted 585
8 SASI_Hs01_00245109 predicted 337
9 SASI_Hs01_00245110 predicted 672
10 SASI_Hs01_00245111 predicted 281
11 SASI_Hs01_00245104 predicted 616
12 SASI_Hs01_00245107 predicted 212
13 SASI_Hs01_00245108 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052530 predicted 1076
2 SASI_Rn02_00198414 predicted 396
3 SASI_Rn01_00052531 predicted 619
4 SASI_Rn01_00052532 predicted 2317
5 SASI_Rn01_00052534 predicted 2409
6 SASI_Rn01_00052535 predicted 1058
7 SASI_Rn01_00052536 predicted 632
8 SASI_Rn01_00052537 predicted 889
9 SASI_Rn01_00052538 predicted 1426
10 SASI_Rn02_00198415 predicted 1245
11 SASI_Rn01_00052533 predicted 431
12 SASI_Rn01_00052539 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292512 predicted 1878
2 SASI_Mm02_00292513 predicted 1120
3 SASI_Mm02_00292514 predicted 1889
4 SASI_Mm02_00292515 predicted 206
5 SASI_Mm02_00292516 predicted 438
6 SASI_Mm02_00292517 predicted 340
7 SASI_Mm02_00292518 predicted 1911
8 SASI_Mm02_00292519 predicted 1142
9 SASI_Mm02_00292520 predicted 585
10 SASI_Mm02_00292521 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292522 predicted 1873
2 SASI_Mm02_00292523 predicted 1111
3 SASI_Mm02_00292524 predicted 1741
4 SASI_Mm02_00292525 predicted 1800
5 SASI_Mm02_00292526 predicted 1879
6 SASI_Mm02_00292527 predicted 200
7 SASI_Mm02_00292528 predicted 338
8 SASI_Mm02_00292529 predicted 929
9 SASI_Mm02_00292530 predicted 1138
10 SASI_Mm02_00292531 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191232 predicted 1952
2 SASI_Mm01_00191233 predicted 1109
3 SASI_Mm02_00325135 predicted 1973
4 SASI_Mm02_00325136 predicted 204
5 SASI_Mm02_00325137 predicted 435
6 SASI_Mm01_00191236 predicted 342
7 SASI_Mm02_00325138 predicted 1988
8 SASI_Mm02_00325139 predicted 1142
9 SASI_Mm02_00325140 predicted 577
10 SASI_Mm01_00191240 predicted 1096
11 SASI_Mm01_00191234 predicted 1748
12 SASI_Mm01_00191235 predicted 1810
13 SASI_Mm01_00191237 predicted 938
14 SASI_Mm01_00191238 predicted 2120
15 SASI_Mm01_00191239 predicted 1187
16 SASI_Mm01_00191241 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057169
VALIDATED
GIT2 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase interacting ArfGAP 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057169.2-2834s1c1
Sequence:CCGGCCAAGCATGTATGTAGAGAAACTCGAGTTTCTCTACATACATGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-618s1c1
Sequence:CCGGGCTGAATTATTGGCAGTATATCTCGAGATATACTGCCAATAATTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-1513s1c1
Sequence:CCGGCCAATGTATATCAGGTGCAAACTCGAGTTTGCACCTGATATACATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-1406s1c1
Sequence:CCGGGCAGCTAATGAAGGTGAATAACTCGAGTTATTCACCTTCATTAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-268s1c1
Sequence:CCGGCCTTGTATAATAACGGTGCTACTCGAGTAGCACCGTTATTATACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057169.3-2477s21c1
Sequence:CCGGAGGCTTTATAAAGTCCAATTTCTCGAGAAATTGGACTTTATAAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057169.3-1406s21c1
Sequence:CCGGAGAGCCTAGATTCAGATTTATCTCGAGATAAATCTGAATCTAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-2771s21c1
Sequence:CCGGGCCTATGGCTGAAACTATAAACTCGAGTTTATAGTTTCAGCCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057169.3-1193s21c1
Sequence:CCGGCCACGCTGGTCATTGACATTCCTCGAGGAATGTCAATGACCAGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-1322s21c1
Sequence:CCGGACAACGATCAGCCCGACTATGCTCGAGCATAGTCGGGCTGATCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-371s21c1
Sequence:CCGGATAACGGTGCTAACTCTATATCTCGAGATATAGAGTTAGCACCGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-403s21c1
Sequence:CCGGTTGCTGGACCCTGCGTCTATTCTCGAGAATAGACGCAGGGTCCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-1129s21c1
Sequence:CCGGGAGTACTCATCAACACGAAATCTCGAGATTTCGTGTTGATGAGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057169
VALIDATED
GIT2 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase interacting ArfGAP 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057169.2-2834s1c1
Sequence:CCGGCCAAGCATGTATGTAGAGAAACTCGAGTTTCTCTACATACATGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-618s1c1
Sequence:CCGGGCTGAATTATTGGCAGTATATCTCGAGATATACTGCCAATAATTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-1513s1c1
Sequence:CCGGCCAATGTATATCAGGTGCAAACTCGAGTTTGCACCTGATATACATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-1406s1c1
Sequence:CCGGGCAGCTAATGAAGGTGAATAACTCGAGTTATTCACCTTCATTAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-268s1c1
Sequence:CCGGCCTTGTATAATAACGGTGCTACTCGAGTAGCACCGTTATTATACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057169.3-2477s21c1
Sequence:CCGGAGGCTTTATAAAGTCCAATTTCTCGAGAAATTGGACTTTATAAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057169.3-1406s21c1
Sequence:CCGGAGAGCCTAGATTCAGATTTATCTCGAGATAAATCTGAATCTAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-2771s21c1
Sequence:CCGGGCCTATGGCTGAAACTATAAACTCGAGTTTATAGTTTCAGCCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057169.3-1193s21c1
Sequence:CCGGCCACGCTGGTCATTGACATTCCTCGAGGAATGTCAATGACCAGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-1322s21c1
Sequence:CCGGACAACGATCAGCCCGACTATGCTCGAGCATAGTCGGGCTGATCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-371s21c1
Sequence:CCGGATAACGGTGCTAACTCTATATCTCGAGATATAGAGTTAGCACCGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-403s21c1
Sequence:CCGGTTGCTGGACCCTGCGTCTATTCTCGAGAATAGACGCAGGGTCCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-1129s21c1
Sequence:CCGGGAGTACTCATCAACACGAAATCTCGAGATTTCGTGTTGATGAGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057169
VALIDATED
GIT2 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase interacting ArfGAP 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057169.2-2834s1c1
Sequence:CCGGCCAAGCATGTATGTAGAGAAACTCGAGTTTCTCTACATACATGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-618s1c1
Sequence:CCGGGCTGAATTATTGGCAGTATATCTCGAGATATACTGCCAATAATTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-1513s1c1
Sequence:CCGGCCAATGTATATCAGGTGCAAACTCGAGTTTGCACCTGATATACATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-1406s1c1
Sequence:CCGGGCAGCTAATGAAGGTGAATAACTCGAGTTATTCACCTTCATTAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057169.2-268s1c1
Sequence:CCGGCCTTGTATAATAACGGTGCTACTCGAGTAGCACCGTTATTATACAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057169.3-2477s21c1
Sequence:CCGGAGGCTTTATAAAGTCCAATTTCTCGAGAAATTGGACTTTATAAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057169.3-1406s21c1
Sequence:CCGGAGAGCCTAGATTCAGATTTATCTCGAGATAAATCTGAATCTAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-2771s21c1
Sequence:CCGGGCCTATGGCTGAAACTATAAACTCGAGTTTATAGTTTCAGCCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057169.3-1193s21c1
Sequence:CCGGCCACGCTGGTCATTGACATTCCTCGAGGAATGTCAATGACCAGCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-1322s21c1
Sequence:CCGGACAACGATCAGCCCGACTATGCTCGAGCATAGTCGGGCTGATCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-371s21c1
Sequence:CCGGATAACGGTGCTAACTCTATATCTCGAGATATAGAGTTAGCACCGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-403s21c1
Sequence:CCGGTTGCTGGACCCTGCGTCTATTCTCGAGAATAGACGCAGGGTCCAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_057169.3-1129s21c1
Sequence:CCGGGAGTACTCATCAACACGAAATCTCGAGATTTCGTGTTGATGAGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019834
VALIDATED
GIT2 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase interacting ArfGAP 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019834.2-4560s1c1
Sequence:CCGGCCACGGTCTTTACTTGCCAAACTCGAGTTTGGCAAGTAAAGACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019834.2-733s1c1
Sequence:CCGGCCTGTTGACTATGCAAGGCAACTCGAGTTGCCTTGCATAGTCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1117s1c1
Sequence:CCGGAGACAGAAATTAGCTCGGTTTCTCGAGAAACCGAGCTAATTTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1906s1c1
Sequence:CCGGGAGAGGATACACGTTGCTGTACTCGAGTACAGCAACGTGTATCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1118s1c1
Sequence:CCGGGACAGAAATTAGCTCGGTTTACTCGAGTAAACCGAGCTAATTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-832s21c1
Sequence:CCGGGGCCGGAAACCAGATCATAAACTCGAGTTTATGATCTGGTTTCCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019834.3-1115s21c1
Sequence:CCGGGACAGAAATTAGCTCGGTTTACTCGAGTAAACCGAGCTAATTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-332s21c1
Sequence:CCGGACAATGGTGCTAACTCTATATCTCGAGATATAGAGTTAGCACCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-933s21c1
Sequence:CCGGTCAATCTCTGAGTAATCATTTCTCGAGAAATGATTACTCAGAGATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019834.3-2536s21c1
Sequence:CCGGCCCATGCCTAAAGCTATAATTCTCGAGAATTATAGCTTTAGGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019834
VALIDATED
GIT2 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase interacting ArfGAP 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019834.2-4560s1c1
Sequence:CCGGCCACGGTCTTTACTTGCCAAACTCGAGTTTGGCAAGTAAAGACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019834.2-733s1c1
Sequence:CCGGCCTGTTGACTATGCAAGGCAACTCGAGTTGCCTTGCATAGTCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1117s1c1
Sequence:CCGGAGACAGAAATTAGCTCGGTTTCTCGAGAAACCGAGCTAATTTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1906s1c1
Sequence:CCGGGAGAGGATACACGTTGCTGTACTCGAGTACAGCAACGTGTATCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1118s1c1
Sequence:CCGGGACAGAAATTAGCTCGGTTTACTCGAGTAAACCGAGCTAATTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-832s21c1
Sequence:CCGGGGCCGGAAACCAGATCATAAACTCGAGTTTATGATCTGGTTTCCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019834.3-1115s21c1
Sequence:CCGGGACAGAAATTAGCTCGGTTTACTCGAGTAAACCGAGCTAATTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-332s21c1
Sequence:CCGGACAATGGTGCTAACTCTATATCTCGAGATATAGAGTTAGCACCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-933s21c1
Sequence:CCGGTCAATCTCTGAGTAATCATTTCTCGAGAAATGATTACTCAGAGATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019834.3-2536s21c1
Sequence:CCGGCCCATGCCTAAAGCTATAATTCTCGAGAATTATAGCTTTAGGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019834
VALIDATED
GIT2 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase interacting ArfGAP 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019834.2-4560s1c1
Sequence:CCGGCCACGGTCTTTACTTGCCAAACTCGAGTTTGGCAAGTAAAGACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019834.2-733s1c1
Sequence:CCGGCCTGTTGACTATGCAAGGCAACTCGAGTTGCCTTGCATAGTCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1117s1c1
Sequence:CCGGAGACAGAAATTAGCTCGGTTTCTCGAGAAACCGAGCTAATTTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1906s1c1
Sequence:CCGGGAGAGGATACACGTTGCTGTACTCGAGTACAGCAACGTGTATCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019834.2-1118s1c1
Sequence:CCGGGACAGAAATTAGCTCGGTTTACTCGAGTAAACCGAGCTAATTTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-832s21c1
Sequence:CCGGGGCCGGAAACCAGATCATAAACTCGAGTTTATGATCTGGTTTCCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019834.3-1115s21c1
Sequence:CCGGGACAGAAATTAGCTCGGTTTACTCGAGTAAACCGAGCTAATTTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-332s21c1
Sequence:CCGGACAATGGTGCTAACTCTATATCTCGAGATATAGAGTTAGCACCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019834.3-933s21c1
Sequence:CCGGTCAATCTCTGAGTAATCATTTCTCGAGAAATGATTACTCAGAGATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019834.3-2536s21c1
Sequence:CCGGCCCATGCCTAAAGCTATAATTCTCGAGAATTATAGCTTTAGGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)