EMAIL THIS PAGE TO A FRIEND

GJA10

gap junction protein, alpha 10, 62kDa

63 Gene Product Result for
Synonyms: CX62 RP11-63K6.6
UniProtKB ID: Q969M2
Gene ID:
Human(84694) Summary: Connexins, such as GJA10, are involved in the formation of gap junctions, intercellular conduits that directly connect the cytoplasms of contacting cells. Each gap junction channel is formed by docking of 2 hemichannels, each of which contains 6 connexin subunits (Sohl et al., 2003 [PubMed 12881038]
Mouse(14610) gap junction protein, alpha 10
Rat(313126) gap junction protein, alpha 10
domestic guinea pig(100730341) gap junction protein, alpha 10, 62kDa
naked mole-rat(101700355) gap junction protein, alpha 10, 62kDa
sheep(101113598) gap junction protein, alpha 10, 62kDa
chicken(771878) gap junction protein, alpha 10, 62kDa
cow(100138447) gap junction protein, alpha 10, 62kDa
Horse(100065787) gap junction protein, alpha 10, 62kDa
dog(100684307) gap junction protein, alpha 9, 59kDa
domestic cat(101095659) gap junction protein, alpha 10, 62kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010289 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010289 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010289 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073401 MISSION® esiRNA esiRNA targeting mouse Gja10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032602 Rosetta Predictions human pricing
XM_001063402 Rosetta Predictions rat pricing
XM_232859 Rosetta Predictions rat pricing
NM_010289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228194 predicted 235
2 SASI_Hs01_00228195 predicted 210
3 SASI_Hs01_00228196 predicted 447
4 SASI_Hs02_00360151 predicted 376
5 SASI_Hs02_00360152 predicted 504
6 SASI_Hs01_00228198 predicted 856
7 SASI_Hs01_00228199 predicted 801
8 SASI_Hs01_00228200 predicted 503
9 SASI_Hs01_00228201 predicted 469
10 SASI_Hs01_00228202 predicted 1122
11 SASI_Hs01_00228197 predicted 430
12 SASI_Hs01_00228203 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306991 predicted 1529
2 SASI_Rn02_00306992 predicted 1248
3 SASI_Rn02_00306993 predicted 925
4 SASI_Rn02_00306994 predicted 1144
5 SASI_Rn02_00306995 predicted 901
6 SASI_Rn02_00306996 predicted 372
7 SASI_Rn02_00306997 predicted 631
8 SASI_Rn02_00306998 predicted 778
9 SASI_Rn02_00306999 predicted 481
10 SASI_Rn02_00307000 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123942 predicted 1530
2 SASI_Rn01_00123943 predicted 1253
3 SASI_Rn01_00123944 predicted 620
4 SASI_Rn02_00387313 predicted 1449
5 SASI_Rn01_00123946 predicted 473
6 SASI_Rn01_00123947 predicted 226
7 SASI_Rn01_00123948 predicted 631
8 SASI_Rn01_00123949 predicted 480
9 SASI_Rn01_00123950 predicted 1255
10 SASI_Rn01_00123951 predicted 414
11 SASI_Rn01_00123945 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318253 predicted 333
2 SASI_Mm02_00318254 predicted 799
3 SASI_Mm01_00094215 predicted 670
4 SASI_Mm01_00094216 predicted 282
5 SASI_Mm02_00318255 predicted 1256
6 SASI_Mm02_00318256 predicted 765
7 SASI_Mm02_00318257 predicted 508
8 SASI_Mm02_00318258 predicted 873
9 SASI_Mm02_00318259 predicted 804
10 SASI_Mm01_00094221 predicted 849
11 SASI_Mm01_00094212 predicted 802
12 SASI_Mm01_00094213 predicted 883
13 SASI_Mm01_00094214 predicted 378
14 SASI_Mm01_00094217 predicted 507
15 SASI_Mm01_00094218 predicted 1134
16 SASI_Mm01_00094219 predicted 864
17 SASI_Mm01_00094220 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032602
GJA10 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 10, 62kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-1459s1c1
Sequence:CCGGCCGATCATGGAACTATCACAACTCGAGTTGTGATAGTTCCATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-768s1c1
Sequence:CCGGCCCTCCATTCCATTTGAAGAACTCGAGTTCTTCAAATGGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-873s1c1
Sequence:CCGGCATTCGAGTTAATGTGCCAAACTCGAGTTTGGCACATTAACTCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-451s21c1
Sequence:CCGGGGATGTCTGCTGCGTACTTATCTCGAGATAAGTACGCAGCAGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-171s1c2
Sequence:CCGGGCAGCCAGGTTGCAACAATATCTCGAGATATTGTTGCAACCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-1603s21c1
Sequence:CCGGTCGATACATTCAGTTAAATTCCTCGAGGAATTTAACTGAATGTATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-509s21c1
Sequence:CCGGGATTCATGATAGGCCAATATACTCGAGTATATTGGCCTATCATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-1343s21c1
Sequence:CCGGGAAGCTCTGGTTCTCGGAATACTCGAGTATTCCGAGAACCAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032602
GJA10 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 10, 62kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-1459s1c1
Sequence:CCGGCCGATCATGGAACTATCACAACTCGAGTTGTGATAGTTCCATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-768s1c1
Sequence:CCGGCCCTCCATTCCATTTGAAGAACTCGAGTTCTTCAAATGGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-873s1c1
Sequence:CCGGCATTCGAGTTAATGTGCCAAACTCGAGTTTGGCACATTAACTCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-451s21c1
Sequence:CCGGGGATGTCTGCTGCGTACTTATCTCGAGATAAGTACGCAGCAGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-171s1c2
Sequence:CCGGGCAGCCAGGTTGCAACAATATCTCGAGATATTGTTGCAACCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-1603s21c1
Sequence:CCGGTCGATACATTCAGTTAAATTCCTCGAGGAATTTAACTGAATGTATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-509s21c1
Sequence:CCGGGATTCATGATAGGCCAATATACTCGAGTATATTGGCCTATCATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-1343s21c1
Sequence:CCGGGAAGCTCTGGTTCTCGGAATACTCGAGTATTCCGAGAACCAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032602
GJA10 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 10, 62kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-1459s1c1
Sequence:CCGGCCGATCATGGAACTATCACAACTCGAGTTGTGATAGTTCCATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-768s1c1
Sequence:CCGGCCCTCCATTCCATTTGAAGAACTCGAGTTCTTCAAATGGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-873s1c1
Sequence:CCGGCATTCGAGTTAATGTGCCAAACTCGAGTTTGGCACATTAACTCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-451s21c1
Sequence:CCGGGGATGTCTGCTGCGTACTTATCTCGAGATAAGTACGCAGCAGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032602.1-171s1c2
Sequence:CCGGGCAGCCAGGTTGCAACAATATCTCGAGATATTGTTGCAACCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-1603s21c1
Sequence:CCGGTCGATACATTCAGTTAAATTCCTCGAGGAATTTAACTGAATGTATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-509s21c1
Sequence:CCGGGATTCATGATAGGCCAATATACTCGAGTATATTGGCCTATCATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032602.1-1343s21c1
Sequence:CCGGGAAGCTCTGGTTCTCGGAATACTCGAGTATTCCGAGAACCAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010289
GJA10 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 10, 62kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-288s1c1
Sequence:CCGGCCTTTATAGACTCAGGGACTTCTCGAGAAGTCCCTGAGTCTATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-1132s1c1
Sequence:CCGGCGTCCATCATCTGCGTTAGAACTCGAGTTCTAACGCAGATGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-878s1c1
Sequence:CCGGGAGTCAATATACCACGGTCTACTCGAGTAGACCGTGGTATATTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-462s1c1
Sequence:CCGGGCGCACCTATGTCTTACACATCTCGAGATGTGTAAGACATAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-1346s1c1
Sequence:CCGGGCTCACGGTCTCTGAATAGTTCTCGAGAACTATTCAGAGACCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010289
GJA10 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 10, 62kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-288s1c1
Sequence:CCGGCCTTTATAGACTCAGGGACTTCTCGAGAAGTCCCTGAGTCTATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-1132s1c1
Sequence:CCGGCGTCCATCATCTGCGTTAGAACTCGAGTTCTAACGCAGATGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-878s1c1
Sequence:CCGGGAGTCAATATACCACGGTCTACTCGAGTAGACCGTGGTATATTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-462s1c1
Sequence:CCGGGCGCACCTATGTCTTACACATCTCGAGATGTGTAAGACATAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-1346s1c1
Sequence:CCGGGCTCACGGTCTCTGAATAGTTCTCGAGAACTATTCAGAGACCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010289
GJA10 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 10, 62kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-288s1c1
Sequence:CCGGCCTTTATAGACTCAGGGACTTCTCGAGAAGTCCCTGAGTCTATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-1132s1c1
Sequence:CCGGCGTCCATCATCTGCGTTAGAACTCGAGTTCTAACGCAGATGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-878s1c1
Sequence:CCGGGAGTCAATATACCACGGTCTACTCGAGTAGACCGTGGTATATTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-462s1c1
Sequence:CCGGGCGCACCTATGTCTTACACATCTCGAGATGTGTAAGACATAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010289.1-1346s1c1
Sequence:CCGGGCTCACGGTCTCTGAATAGTTCTCGAGAACTATTCAGAGACCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks