EMAIL THIS PAGE TO A FRIEND

GJA1

gap junction protein, alpha 1, 43kDa

185 Gene Product Result for
Synonyms: AVSD3 CMDR CX43 DFNB38 GJAL HLHS1 HSS ODDD
UniProtKB ID: P17302, B2R5U9, Q6FHU1, Q9Y5I8
Gene ID:
Human(2697) Summary: This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia and heart malformations. [provided by RefSeq, Jul 2008]
Mouse(14609) gap junction protein, alpha 1
Rat(24392) gap junction protein, alpha 1
chicken(395278) gap junction protein, alpha 1, 43kDa
cow(281193) gap junction protein, alpha 1, 43kDa
domestic cat(100500936) gap junction protein, alpha 1, 43kDa
dog(403418) gap junction protein, alpha 1, 43kDa
domestic cat(101100211) gap junction protein, alpha 1, 43kDa
sheep(101122284) gap junction protein, alpha 1, 43kDa
Domestic Rabbit(100008935) gap junction protein, alpha 1, 43kDa
sheep(443233) gap junction protein, alpha 1, 43kDa
naked mole-rat(101726706) gap junction protein, alpha 1, 43kDa
domestic guinea pig(100379273) gap junction protein, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501173 Anti-Connexin 43 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1306260 ANTI-CONNEXIN 43(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4501174 Anti-Connexin 43, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4501175 Anti-Connexin 43, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C6219 Anti-Connexin-43 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mammals, human
immunocytochemistry, immunofluorescence, immunohistochemistry, microarray, western blot pricing
SAB4300504 Anti-GJA1 (Ab-367) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB2501246 Anti-GJA1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human
ELISA, western blot pricing
AV36598 Anti-GJA1 antibody produced in rabbit affinity isolated antibody bovine, mouse, rabbit, rabbit, guinea pig, horse, human, canine, sheep, pig, rat
western blot pricing
SAB2900237 Anti-GJA1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution guinea pig, hamster, dog, rat, human, monkey, rabbit, mouse, bovine, pig
immunohistochemistry pricing
SAB2100918 Anti-GJA1 antibody produced in rabbit affinity isolated antibody mouse, canine, rabbit, pig, rat, rabbit, guinea pig, horse, human
western blot pricing
HPA035097 Anti-GJA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4504371 Anti-phospho-Connexin 43 (pSer367) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301326 Anti-phospho-Connexin 43 (pTyr265) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300206 Anti-phospho-GJA1 (pSer368) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
C6344 Monoclonal Anti-Connexin-32 antibody produced in mouse clone CXN-32, ascites fluid, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, microarray, western blot pricing
C8093 Monoclonal Anti-Connexin-43 antibody produced in mouse clone CXN-6, ascites fluid bovine, mouse, human, hamster, rat
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
WH0002697M1 Monoclonal Anti-GJA1 antibody produced in mouse clone 3E5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB1727 Anti-Connexin 43 Antibody This Anti-Connexin 43 Antibody is validated for use in ELISA, IP, WB, IC for the detection of Connexin 43. pricing
MABT901 Anti-Connexin 43 Antibody, C-terminal Antibody, clone P4G9 This mouse monoclonal Anti-Connexin 43, C-terminal, clone P4G9, Cat. No. MABT901 is tested for use in Immunocytochemistry, Immunofluorescence, Immunohistochemistry (Paraffin), and Immunoprecipitation for the detection of Connexin-43. pricing
MABT917 Anti-Connexin 43 Antibody, clone 2F5 This mouse monoclonal Anti-Connexin 43, clone 2F5, Cat. No. MABT917 is tested for use in Immunohistochemistry (Paraffin), Immunofluorescence, and Western Blotting for the detection of Connexin-43. pricing
MAB3067 Anti-Connexin 43 Antibody, clone 4E6.2 Anti-Connexin 43 Antibody, clone 4E6.2 detects level of Connexin 43 & has been published & validated for use in ELISA, IC, IH & WB. pricing
MABT902 Anti-Connexin 43 Antibody, clone P2C4 Anti-Connexin 43 Antibody, clone P2C4, Cat. No. MABT902, is a mouse monoclonal antibody that targets Connexin-43 and is tested for use in Electron Microscopy, Immunocytochemistry, Immunohistochemistry (Paraffin), Immunoprecipitation, and Western Blotting. pricing
MAB3068 Anti-Connexin 43 Antibody, CT Detect Connexin 43 using this Anti-Connexin 43 Antibody, C-terminus validated for use in ELISA, IC, IF, IH, IP & WB. pricing
MABT528 Anti-Connexin 43 Antibody, CT Antibody, clone 1C5.1 Anti-Connexin 43, CT, clone 1C5.1, Cat. No. MABT528 is a mouse monoclonal antibody validated for use in Immunohistochemistry (Paraffin) and Western Blotting for the detection of connexin 43. pricing
MABT528-AF488 Anti-Connexin 43 Antibody, CT Antibody, clone 1C5.1 Antibody, Alexa Fluor® 488 Conjugate This mouse monoclonal Anti-Connexin 43 Antibody, CT, clone 1C5.1, Alexa Fluor® 488 Conjugate, Cat. No. MABT528-AF488 is used for the detection of Connexin 43 by Immunocytochemistry. pricing
AB1728 Anti-Connexin 43 Antibody, CT, cytosolic Anti-Connexin 43 Antibody, C-terminus, cytosolic is an antibody against Connexin 43 for use in ELISA, IF, IH, IP & WB. pricing
MABT903 Anti-Connexin 43 Antibody, N-terminal Antibody, clone P1E11.B19 This mouse monoclonal Anti-Connexin 43, N-terminal, clone P1E11.B19, Cat. No. MABT903 is tested for use in Immunocytochemistry and Western Blotting for the detection of Connexin-43. pricing
AB3841 Anti-Connexin 43 Antibody, phospho-specific (Ser368) This Anti-Connexin 43 Antibody, phospho-specific (Ser368) is validated for use in WB for the detection of Connexin 43. pricing
05-763 Anti-Connexin 43 (Cx43) Antibody, α1 subunit Anti-Connexin 43 (Cx43) Antibody, α1 subunit detects level of Connexin 43 (Cx43) & has been published & validated for use in WB, IH. pricing
AG678 Connexin 43, control peptide for MAB3067 pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000165 Rosetta Predictions human pricing
NM_012567 Rosetta Predictions rat pricing
NM_010288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133890 predicted 1450
2 SASI_Hs01_00133891 predicted 577
3 SASI_Hs01_00133893 predicted 1108
4 SASI_Hs01_00133894 predicted 703
5 SASI_Hs01_00133895 predicted 1260
6 SASI_Hs01_00133896 predicted 620
7 SASI_Hs01_00133897 predicted 1393
8 SASI_Hs02_00301994 predicted 704
9 SASI_Hs02_00301995 predicted 1106
10 SASI_Hs01_00133899 predicted 643
11 SASI_Hs01_00133892 predicted 1049
12 SASI_Hs01_00133898 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047074 predicted 1056
2 SASI_Rn01_00047075 predicted 1029
3 SASI_Rn01_00047076 predicted 1074
4 SASI_Rn01_00047077 predicted 858
5 SASI_Rn01_00047078 predicted 1126
6 SASI_Rn01_00047080 predicted 585
7 SASI_Rn01_00047081 predicted 326
8 SASI_Rn01_00047082 predicted 602
9 SASI_Rn01_00047083 predicted 1330
10 SASI_Rn02_00259681 predicted 898
11 SASI_Rn01_00047079 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318249 predicted 673
2 SASI_Mm01_00135294 predicted 822
3 SASI_Mm01_00135296 predicted 624
4 SASI_Mm01_00135298 predicted 1104
5 SASI_Mm01_00135300 predicted 777
6 SASI_Mm02_00318250 predicted 616
7 SASI_Mm01_00135302 predicted 599
8 SASI_Mm01_00135303 predicted 681
9 SASI_Mm02_00318251 predicted 761
10 SASI_Mm02_00318252 predicted 602
11 SASI_Mm01_00135295 predicted 467
12 SASI_Mm01_00135297 predicted 332
13 SASI_Mm01_00135299 predicted 343
14 SASI_Mm01_00135301 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000165
VALIDATED
GJA1 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 1, 43kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-952s21c1
Sequence:CCGGGGGCGTTAAGGATCGGGTTAACTCGAGTTAACCCGATCCTTAACGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-1132s21c1
Sequence:CCGGCAATTCTTCTTGCCGCAATTACTCGAGTAATTGCGGCAAGAAGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-596s21c1
Sequence:CCGGGCCCAAACTGATGGTGTCAATCTCGAGATTGACACCATCAGTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000165.3-1742s21c1
Sequence:CCGGGGTGGTAATTGTGGCTAAATACTCGAGTATTTAGCCACAATTACCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-482s21c1
Sequence:CCGGTGGGTCCTGCAGATCATATTTCTCGAGAAATATGATCTGCAGGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-1079s1c1
Sequence:CCGGGCGACAGAAACAATTCTTCTTCTCGAGAAGAAGAATTGTTTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-977s1c1
Sequence:CCGGCCAAAGACTGTGGGTCTCAAACTCGAGTTTGAGACCCACAGTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-553s1c1
Sequence:CCGGGCCCAAACTGATGGTGTCAATCTCGAGATTGACACCATCAGTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-237s1c1
Sequence:CCGGCCTTGACAAGGTTCAAGCCTACTCGAGTAGGCTTGAACCTTGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000165.2-723s1c1
Sequence:CCGGCCAGTGGTACATCTATGGATTCTCGAGAATCCATAGATGTACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000165
VALIDATED
GJA1 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 1, 43kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-952s21c1
Sequence:CCGGGGGCGTTAAGGATCGGGTTAACTCGAGTTAACCCGATCCTTAACGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-1132s21c1
Sequence:CCGGCAATTCTTCTTGCCGCAATTACTCGAGTAATTGCGGCAAGAAGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-596s21c1
Sequence:CCGGGCCCAAACTGATGGTGTCAATCTCGAGATTGACACCATCAGTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000165.3-1742s21c1
Sequence:CCGGGGTGGTAATTGTGGCTAAATACTCGAGTATTTAGCCACAATTACCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-482s21c1
Sequence:CCGGTGGGTCCTGCAGATCATATTTCTCGAGAAATATGATCTGCAGGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-1079s1c1
Sequence:CCGGGCGACAGAAACAATTCTTCTTCTCGAGAAGAAGAATTGTTTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-977s1c1
Sequence:CCGGCCAAAGACTGTGGGTCTCAAACTCGAGTTTGAGACCCACAGTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-553s1c1
Sequence:CCGGGCCCAAACTGATGGTGTCAATCTCGAGATTGACACCATCAGTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-237s1c1
Sequence:CCGGCCTTGACAAGGTTCAAGCCTACTCGAGTAGGCTTGAACCTTGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000165.2-723s1c1
Sequence:CCGGCCAGTGGTACATCTATGGATTCTCGAGAATCCATAGATGTACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000165
VALIDATED
GJA1 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 1, 43kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-952s21c1
Sequence:CCGGGGGCGTTAAGGATCGGGTTAACTCGAGTTAACCCGATCCTTAACGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-1132s21c1
Sequence:CCGGCAATTCTTCTTGCCGCAATTACTCGAGTAATTGCGGCAAGAAGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-596s21c1
Sequence:CCGGGCCCAAACTGATGGTGTCAATCTCGAGATTGACACCATCAGTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000165.3-1742s21c1
Sequence:CCGGGGTGGTAATTGTGGCTAAATACTCGAGTATTTAGCCACAATTACCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000165.3-482s21c1
Sequence:CCGGTGGGTCCTGCAGATCATATTTCTCGAGAAATATGATCTGCAGGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-1079s1c1
Sequence:CCGGGCGACAGAAACAATTCTTCTTCTCGAGAAGAAGAATTGTTTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-977s1c1
Sequence:CCGGCCAAAGACTGTGGGTCTCAAACTCGAGTTTGAGACCCACAGTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-553s1c1
Sequence:CCGGGCCCAAACTGATGGTGTCAATCTCGAGATTGACACCATCAGTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000165.2-237s1c1
Sequence:CCGGCCTTGACAAGGTTCAAGCCTACTCGAGTAGGCTTGAACCTTGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000165.2-723s1c1
Sequence:CCGGCCAGTGGTACATCTATGGATTCTCGAGAATCCATAGATGTACCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010288
VALIDATED
GJA1 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 1, 43kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-1114s21c1
Sequence:CCGGCAATTCCTCCTGCCGCAATTACTCGAGTAATTGCGGCAGGAGGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-464s21c1
Sequence:CCGGTGGGTCCTTCAGATCATATTCCTCGAGGAATATGATCTGAAGGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010288.3-1361s21c1
Sequence:CCGGCCTGATGACCTGGAGATTTAACTCGAGTTAAATCTCCAGGTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-913s21c1
Sequence:CCGGGCTCTTCTATGTCTTCTTCAACTCGAGTTGAAGAAGACATAGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010288.3-2049s21c1
Sequence:CCGGCCCACCTTTGTGTCTTCCATACTCGAGTATGGAAGACACAAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-635s1c1
Sequence:CCGGCCTGCTGAGAACCTACATCATCTCGAGATGATGTAGGTTCTCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-866s1c1
Sequence:CCGGGCTCTTCTATGTCTTCTTCAACTCGAGTTGAAGAAGACATAGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-2002s1c1
Sequence:CCGGCCCACCTTTGTGTCTTCCATACTCGAGTATGGAAGACACAAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010288.2-569s1c1
Sequence:CCGGGCAGATTGAAATCAAGAAGTTCTCGAGAACTTCTTGATTTCAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010288.2-470s1c1
Sequence:CCGGCGTGTTCTATGTGATGAGAAACTCGAGTTTCTCATCACATAGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010288
VALIDATED
GJA1 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 1, 43kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-1114s21c1
Sequence:CCGGCAATTCCTCCTGCCGCAATTACTCGAGTAATTGCGGCAGGAGGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-464s21c1
Sequence:CCGGTGGGTCCTTCAGATCATATTCCTCGAGGAATATGATCTGAAGGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010288.3-1361s21c1
Sequence:CCGGCCTGATGACCTGGAGATTTAACTCGAGTTAAATCTCCAGGTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-913s21c1
Sequence:CCGGGCTCTTCTATGTCTTCTTCAACTCGAGTTGAAGAAGACATAGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010288.3-2049s21c1
Sequence:CCGGCCCACCTTTGTGTCTTCCATACTCGAGTATGGAAGACACAAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-635s1c1
Sequence:CCGGCCTGCTGAGAACCTACATCATCTCGAGATGATGTAGGTTCTCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-866s1c1
Sequence:CCGGGCTCTTCTATGTCTTCTTCAACTCGAGTTGAAGAAGACATAGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-2002s1c1
Sequence:CCGGCCCACCTTTGTGTCTTCCATACTCGAGTATGGAAGACACAAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010288.2-569s1c1
Sequence:CCGGGCAGATTGAAATCAAGAAGTTCTCGAGAACTTCTTGATTTCAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010288.2-470s1c1
Sequence:CCGGCGTGTTCTATGTGATGAGAAACTCGAGTTTCTCATCACATAGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010288
VALIDATED
GJA1 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 1, 43kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-1114s21c1
Sequence:CCGGCAATTCCTCCTGCCGCAATTACTCGAGTAATTGCGGCAGGAGGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-464s21c1
Sequence:CCGGTGGGTCCTTCAGATCATATTCCTCGAGGAATATGATCTGAAGGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010288.3-1361s21c1
Sequence:CCGGCCTGATGACCTGGAGATTTAACTCGAGTTAAATCTCCAGGTCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010288.3-913s21c1
Sequence:CCGGGCTCTTCTATGTCTTCTTCAACTCGAGTTGAAGAAGACATAGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010288.3-2049s21c1
Sequence:CCGGCCCACCTTTGTGTCTTCCATACTCGAGTATGGAAGACACAAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-635s1c1
Sequence:CCGGCCTGCTGAGAACCTACATCATCTCGAGATGATGTAGGTTCTCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-866s1c1
Sequence:CCGGGCTCTTCTATGTCTTCTTCAACTCGAGTTGAAGAAGACATAGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010288.2-2002s1c1
Sequence:CCGGCCCACCTTTGTGTCTTCCATACTCGAGTATGGAAGACACAAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010288.2-569s1c1
Sequence:CCGGGCAGATTGAAATCAAGAAGTTCTCGAGAACTTCTTGATTTCAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010288.2-470s1c1
Sequence:CCGGCGTGTTCTATGTGATGAGAAACTCGAGTTTCTCATCACATAGAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)