EMAIL THIS PAGE TO A FRIEND

GJA3

gap junction protein, alpha 3, 46kDa

60 Gene Product Result for
Synonyms: CTRCT14 CX46 CZP3
UniProtKB ID: Q9Y6H8, Q0VAB7, Q9H537
Gene ID:
Human(2700) Summary: The protein encoded by this gene is a connexin and is a component of lens fiber gap junctions. Defects in this gene are a cause of zonular pulverulent cataract type 3 (CZP3). [provided by RefSeq, Jan 2010]
Mouse(14611) gap junction protein, alpha 3
Rat(79217) gap junction protein, alpha 3
Zebrafish(387533) gap junction protein, alpha 3
cow(100140301) gap junction protein, alpha 3, 46kDa
domestic cat(101092573) gap junction protein, alpha 3, 46kDa
dog(486052) gap junction protein, alpha 3, 46kDa
chicken(428084) gap junction protein, alpha 3, 46kDa
sheep(101119228) gap junction protein, alpha 3, 46kDa
naked mole-rat(101711442) gap junction protein, alpha 3, 46kDa
domestic guinea pig(100724048) gap junction protein, alpha 3, 46kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033001 MISSION® esiRNA esiRNA targeting mouse Gja3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021954 Rosetta Predictions human pricing
NM_024376 Rosetta Predictions rat pricing
NM_016975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355279 predicted 1811
2 SASI_Hs02_00355280 predicted 1711
3 SASI_Hs02_00355281 predicted 1633
4 SASI_Hs02_00355282 predicted 1783
5 SASI_Hs02_00355283 predicted 1838
6 SASI_Hs02_00355284 predicted 1807
7 SASI_Hs02_00355285 predicted 1680
8 SASI_Hs02_00355286 predicted 1893
9 SASI_Hs02_00355287 predicted 1962
10 SASI_Hs02_00355288 predicted 1542
11 SASI_Hs01_00167607 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065450 predicted 933
2 SASI_Rn01_00065451 predicted 1107
3 SASI_Rn01_00065452 predicted 1015
4 SASI_Rn01_00065453 predicted 934
5 SASI_Rn01_00065454 predicted 1119
6 SASI_Rn01_00065456 predicted 1172
7 SASI_Rn01_00065457 predicted 1095
8 SASI_Rn01_00065459 predicted 862
9 SASI_Rn02_00263966 predicted 1105
10 SASI_Rn02_00263967 predicted 1065
11 SASI_Rn01_00065455 predicted 1197
12 SASI_Rn01_00065458 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129095 predicted 375
2 SASI_Mm01_00129096 predicted 879
3 SASI_Mm01_00129097 predicted 1060
4 SASI_Mm01_00129099 predicted 610
5 SASI_Mm01_00129100 predicted 1052
6 SASI_Mm01_00129101 predicted 1123
7 SASI_Mm01_00129102 predicted 1135
8 SASI_Mm01_00129103 predicted 429
9 SASI_Mm01_00129104 predicted 1013
10 SASI_Mm02_00323827 predicted 1086
11 SASI_Mm01_00129098 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021954
VALIDATED
GJA3 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 3, 46kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021954.3-968s21c1
Sequence:CCGGATCGGGTTCCCACCCTACTATCTCGAGATAGTAGGGTGGGAACCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021954.3-1628s21c1
Sequence:CCGGATCAGGTTTCCGTGTTCAATGCTCGAGCATTGAACACGGAAACCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021954.3-673s21c1
Sequence:CCGGGTACTTTCTGTACGGCTTCGACTCGAGTCGAAGCCGTACAGAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021954.3-1816s21c1
Sequence:CCGGGGTATCCTGCAGTCCCTTTAGCTCGAGCTAAAGGGACTGCAGGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021954.2-301s1c1
Sequence:CCGGCGCATGGAAGAGAAGAAGAAACTCGAGTTTCTTCTTCTCTTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-648s1c1
Sequence:CCGGGCTCAACATGCTGGAGATCTACTCGAGTAGATCTCCAGCATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-435s1c1
Sequence:CCGGGCTGCGGACCTACGTCTTCAACTCGAGTTGAAGACGTAGGTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021954.2-53s1c1
Sequence:CCGGCCACGGTCATCGGCAAGGTTTCTCGAGAAACCTTGCCGATGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-84s1c1
Sequence:CCGGGCTGTTCATCTTCCGCATCTTCTCGAGAAGATGCGGAAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021954
VALIDATED
GJA3 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 3, 46kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021954.3-968s21c1
Sequence:CCGGATCGGGTTCCCACCCTACTATCTCGAGATAGTAGGGTGGGAACCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021954.3-1628s21c1
Sequence:CCGGATCAGGTTTCCGTGTTCAATGCTCGAGCATTGAACACGGAAACCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021954.3-673s21c1
Sequence:CCGGGTACTTTCTGTACGGCTTCGACTCGAGTCGAAGCCGTACAGAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021954.3-1816s21c1
Sequence:CCGGGGTATCCTGCAGTCCCTTTAGCTCGAGCTAAAGGGACTGCAGGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021954.2-301s1c1
Sequence:CCGGCGCATGGAAGAGAAGAAGAAACTCGAGTTTCTTCTTCTCTTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-648s1c1
Sequence:CCGGGCTCAACATGCTGGAGATCTACTCGAGTAGATCTCCAGCATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-435s1c1
Sequence:CCGGGCTGCGGACCTACGTCTTCAACTCGAGTTGAAGACGTAGGTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021954.2-53s1c1
Sequence:CCGGCCACGGTCATCGGCAAGGTTTCTCGAGAAACCTTGCCGATGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-84s1c1
Sequence:CCGGGCTGTTCATCTTCCGCATCTTCTCGAGAAGATGCGGAAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021954
VALIDATED
GJA3 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 3, 46kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021954.3-968s21c1
Sequence:CCGGATCGGGTTCCCACCCTACTATCTCGAGATAGTAGGGTGGGAACCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021954.3-1628s21c1
Sequence:CCGGATCAGGTTTCCGTGTTCAATGCTCGAGCATTGAACACGGAAACCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021954.3-673s21c1
Sequence:CCGGGTACTTTCTGTACGGCTTCGACTCGAGTCGAAGCCGTACAGAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021954.3-1816s21c1
Sequence:CCGGGGTATCCTGCAGTCCCTTTAGCTCGAGCTAAAGGGACTGCAGGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021954.2-301s1c1
Sequence:CCGGCGCATGGAAGAGAAGAAGAAACTCGAGTTTCTTCTTCTCTTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-648s1c1
Sequence:CCGGGCTCAACATGCTGGAGATCTACTCGAGTAGATCTCCAGCATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-435s1c1
Sequence:CCGGGCTGCGGACCTACGTCTTCAACTCGAGTTGAAGACGTAGGTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021954.2-53s1c1
Sequence:CCGGCCACGGTCATCGGCAAGGTTTCTCGAGAAACCTTGCCGATGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021954.2-84s1c1
Sequence:CCGGGCTGTTCATCTTCCGCATCTTCTCGAGAAGATGCGGAAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016975
GJA3 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 3, 46kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-946s1c1
Sequence:CCGGCACCCAGTCAAACACTGCAATCTCGAGATTGCAGTGTTTGACTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-664s1c1
Sequence:CCGGGTACTCAACATGCTGGAGATTCTCGAGAATCTCCAGCATGTTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-711s1c1
Sequence:CCGGGCAGGGAGTTACTAACCACTTCTCGAGAAGTGGTTAGTAACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-916s1c1
Sequence:CCGGGTGACTCTAAACGATGCCCAACTCGAGTTGGGCATCGTTTAGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-144s1c1
Sequence:CCGGGCAATCGGACTTCACCTGCAACTCGAGTTGCAGGTGAAGTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016975
GJA3 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 3, 46kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-946s1c1
Sequence:CCGGCACCCAGTCAAACACTGCAATCTCGAGATTGCAGTGTTTGACTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-664s1c1
Sequence:CCGGGTACTCAACATGCTGGAGATTCTCGAGAATCTCCAGCATGTTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-711s1c1
Sequence:CCGGGCAGGGAGTTACTAACCACTTCTCGAGAAGTGGTTAGTAACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-916s1c1
Sequence:CCGGGTGACTCTAAACGATGCCCAACTCGAGTTGGGCATCGTTTAGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-144s1c1
Sequence:CCGGGCAATCGGACTTCACCTGCAACTCGAGTTGCAGGTGAAGTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016975
GJA3 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 3, 46kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-946s1c1
Sequence:CCGGCACCCAGTCAAACACTGCAATCTCGAGATTGCAGTGTTTGACTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-664s1c1
Sequence:CCGGGTACTCAACATGCTGGAGATTCTCGAGAATCTCCAGCATGTTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-711s1c1
Sequence:CCGGGCAGGGAGTTACTAACCACTTCTCGAGAAGTGGTTAGTAACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-916s1c1
Sequence:CCGGGTGACTCTAAACGATGCCCAACTCGAGTTGGGCATCGTTTAGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016975.1-144s1c1
Sequence:CCGGGCAATCGGACTTCACCTGCAACTCGAGTTGCAGGTGAAGTCCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks