EMAIL THIS PAGE TO A FRIEND

GJA4

gap junction protein, alpha 4, 37kDa

63 Gene Product Result for
Synonyms: CX37
Gene ID:
Human(2701) Summary: This gene encodes a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene have been associated with atherosclerosis and a higher risk of myocardial infarction. [provided by RefSeq, Jul 2008]
Mouse(14612) gap junction protein, alpha 4
Rat(25655) gap junction protein, alpha 4
domestic guinea pig(100732947) gap junction protein, alpha 4, 37kDa
naked mole-rat(101705539) gap junction protein, alpha 4, 37kDa
sheep(101107643) gap junction protein, alpha 4, 37kDa
sheep(450186) gap junction protein, alpha 4, 37kDa
chicken(404529) gap junction protein, alpha 4, 37kDa
dog(482485) gap junction protein, alpha 4, 37kDa
cow(538913) gap junction protein, alpha 4, 37kDa
domestic cat(101084041) gap junction protein, alpha 4, 37kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008120 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008120 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008120 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002060 Rosetta Predictions human pricing
NM_021654 Rosetta Predictions rat pricing
NM_008120 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042993 predicted 1223
2 SASI_Hs01_00042994 predicted 1318
3 SASI_Hs01_00042996 predicted 1319
4 SASI_Hs01_00042997 predicted 545
5 SASI_Hs01_00042998 predicted 1218
6 SASI_Hs01_00042999 predicted 1060
7 SASI_Hs01_00043000 predicted 602
8 SASI_Hs01_00043001 predicted 657
9 SASI_Hs02_00333109 predicted 224
10 SASI_Hs02_00333110 predicted 916
11 SASI_Hs01_00042992 predicted 1312
12 SASI_Hs01_00042995 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056603 predicted 406
2 SASI_Rn01_00056604 predicted 542
3 SASI_Rn01_00056605 predicted 521
4 SASI_Rn02_00262645 predicted 960
5 SASI_Rn01_00056606 predicted 672
6 SASI_Rn01_00056607 predicted 944
7 SASI_Rn01_00056609 predicted 311
8 SASI_Rn01_00056610 predicted 1206
9 SASI_Rn01_00056611 predicted 1057
10 SASI_Rn01_00056612 predicted 299
11 SASI_Rn01_00056608 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313183 predicted 836
2 SASI_Mm01_00070773 predicted 768
3 SASI_Mm01_00070774 predicted 593
4 SASI_Mm01_00070775 predicted 613
5 SASI_Mm01_00070776 predicted 960
6 SASI_Mm01_00070777 predicted 302
7 SASI_Mm01_00070778 predicted 357
8 SASI_Mm01_00070780 predicted 473
9 SASI_Mm01_00070781 predicted 1343
10 SASI_Mm01_00070782 predicted 935
11 SASI_Mm01_00070779 predicted 1313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002060
GJA4 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 4, 37kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-208s1c1
Sequence:CCGGGCAGTCAGATTTCGAGTGTAACTCGAGTTACACTCGAAATCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-1039s1c1
Sequence:CCGGCTCTGCTTCTAAGAAGCAGTACTCGAGTACTGCTTCTTAGAAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-541s1c1
Sequence:CCGGGCTCTGCAAGAGTGTGCTAGACTCGAGTCTAGCACACTCTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-467s1c1
Sequence:CCGGGCCAAGATCTCGGTGGCAGAACTCGAGTTCTGCCACCGAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-900s1c1
Sequence:CCGGCCACCTACAATGGGCTCTCATCTCGAGATGAGAGCCCATTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002060.2-1386s21c1
Sequence:CCGGAGGAACCCAGAGCCAACTTACCTCGAGGTAAGTTGGCTCTGGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002060.2-1512s21c1
Sequence:CCGGGACAGAGCTTGTGCCGGATTTCTCGAGAAATCCGGCACAAGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002060.2-223s21c1
Sequence:CCGGGGGTGACGAGCAATCAGATTTCTCGAGAAATCTGATTGCTCGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002060
GJA4 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 4, 37kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-208s1c1
Sequence:CCGGGCAGTCAGATTTCGAGTGTAACTCGAGTTACACTCGAAATCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-1039s1c1
Sequence:CCGGCTCTGCTTCTAAGAAGCAGTACTCGAGTACTGCTTCTTAGAAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-541s1c1
Sequence:CCGGGCTCTGCAAGAGTGTGCTAGACTCGAGTCTAGCACACTCTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-467s1c1
Sequence:CCGGGCCAAGATCTCGGTGGCAGAACTCGAGTTCTGCCACCGAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-900s1c1
Sequence:CCGGCCACCTACAATGGGCTCTCATCTCGAGATGAGAGCCCATTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002060.2-1386s21c1
Sequence:CCGGAGGAACCCAGAGCCAACTTACCTCGAGGTAAGTTGGCTCTGGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002060.2-1512s21c1
Sequence:CCGGGACAGAGCTTGTGCCGGATTTCTCGAGAAATCCGGCACAAGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002060.2-223s21c1
Sequence:CCGGGGGTGACGAGCAATCAGATTTCTCGAGAAATCTGATTGCTCGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002060
GJA4 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 4, 37kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-208s1c1
Sequence:CCGGGCAGTCAGATTTCGAGTGTAACTCGAGTTACACTCGAAATCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-1039s1c1
Sequence:CCGGCTCTGCTTCTAAGAAGCAGTACTCGAGTACTGCTTCTTAGAAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-541s1c1
Sequence:CCGGGCTCTGCAAGAGTGTGCTAGACTCGAGTCTAGCACACTCTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-467s1c1
Sequence:CCGGGCCAAGATCTCGGTGGCAGAACTCGAGTTCTGCCACCGAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002060.1-900s1c1
Sequence:CCGGCCACCTACAATGGGCTCTCATCTCGAGATGAGAGCCCATTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002060.2-1386s21c1
Sequence:CCGGAGGAACCCAGAGCCAACTTACCTCGAGGTAAGTTGGCTCTGGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002060.2-1512s21c1
Sequence:CCGGGACAGAGCTTGTGCCGGATTTCTCGAGAAATCCGGCACAAGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002060.2-223s21c1
Sequence:CCGGGGGTGACGAGCAATCAGATTTCTCGAGAAATCTGATTGCTCGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008120
GJA4 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 4, 37kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-786s1c1
Sequence:CCGGGCCGGGAGATAAAGGCACGAACTCGAGTTCGTGCCTTTATCTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-912s1c1
Sequence:CCGGCCACCTACAACGGGCTCTCATCTCGAGATGAGAGCCCGTTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-553s1c1
Sequence:CCGGGCTGTGTAAGAGTGTGCTGGACTCGAGTCCAGCACACTCTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-425s1c1
Sequence:CCGGCCATCCAAGGACCTACATGTACTCGAGTACATGTAGGTCCTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-1051s1c1
Sequence:CCGGCTCTGCATCCAAGAAGCAGTACTCGAGTACTGCTTCTTGGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008120
GJA4 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 4, 37kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-786s1c1
Sequence:CCGGGCCGGGAGATAAAGGCACGAACTCGAGTTCGTGCCTTTATCTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-912s1c1
Sequence:CCGGCCACCTACAACGGGCTCTCATCTCGAGATGAGAGCCCGTTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-553s1c1
Sequence:CCGGGCTGTGTAAGAGTGTGCTGGACTCGAGTCCAGCACACTCTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-425s1c1
Sequence:CCGGCCATCCAAGGACCTACATGTACTCGAGTACATGTAGGTCCTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-1051s1c1
Sequence:CCGGCTCTGCATCCAAGAAGCAGTACTCGAGTACTGCTTCTTGGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008120
GJA4 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 4, 37kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-786s1c1
Sequence:CCGGGCCGGGAGATAAAGGCACGAACTCGAGTTCGTGCCTTTATCTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-912s1c1
Sequence:CCGGCCACCTACAACGGGCTCTCATCTCGAGATGAGAGCCCGTTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-553s1c1
Sequence:CCGGGCTGTGTAAGAGTGTGCTGGACTCGAGTCCAGCACACTCTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-425s1c1
Sequence:CCGGCCATCCAAGGACCTACATGTACTCGAGTACATGTAGGTCCTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008120.2-1051s1c1
Sequence:CCGGCTCTGCATCCAAGAAGCAGTACTCGAGTACTGCTTCTTGGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks