EMAIL THIS PAGE TO A FRIEND

GJA5

gap junction protein, alpha 5, 40kDa

112 Gene Product Result for
Synonyms: ATFB11 CX40
UniProtKB ID: P36382, Q5T3B6, Q5U0N6
Gene ID:
Human(2702) Summary: This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene may be associated with atrial fibrillation. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]
Mouse(14613) gap junction protein, alpha 5
Rat(50563) gap junction protein, alpha 5
chicken(396502) gap junction protein, alpha 5, 40kDa
cow(539491) gap junction protein, alpha 5, 40kDa
domestic cat(101095909) gap junction protein, alpha 5, 40kDa
dog(483155) gap junction protein, alpha 5, 40kDa
sheep(101115082) gap junction protein, alpha 5, 40kDa
Domestic Rabbit(100009023) gap junction protein, alpha 5, 40kDa
naked mole-rat(101726049) gap junction protein, alpha 5, 40kDa
domestic guinea pig(100729222) gap junction protein, alpha 5, 40kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027981 MISSION® esiRNA esiRNA human GJA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005266 Rosetta Predictions human pricing
NM_181703 Rosetta Predictions human pricing
NM_019280 Rosetta Predictions rat pricing
NM_008121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339304 predicted 1494
2 SASI_Hs01_00116331 predicted 1037
3 SASI_Hs01_00116333 predicted 1356
4 SASI_Hs01_00116334 predicted 1086
5 SASI_Hs02_00339305 predicted 1006
6 SASI_Hs02_00339306 predicted 1366
7 SASI_Hs01_00116335 predicted 1092
8 SASI_Hs01_00116336 predicted 1361
9 SASI_Hs01_00116337 predicted 1466
10 SASI_Hs01_00116338 predicted 1303
11 SASI_Hs01_00116330 predicted 612
12 SASI_Hs01_00116332 predicted 1339
13 SASI_Hs01_00116339 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370303 predicted 1473
2 SASI_Hs01_00053478 predicted 1010
3 SASI_Hs01_00053480 predicted 1336
4 SASI_Hs01_00053481 predicted 1067
5 SASI_Hs02_00370304 predicted 990
6 SASI_Hs02_00370305 predicted 1353
7 SASI_Hs01_00053482 predicted 1071
8 SASI_Hs01_00053483 predicted 1336
9 SASI_Hs01_00053484 predicted 1441
10 SASI_Hs01_00053485 predicted 1281
11 SASI_Hs01_00053477 predicted 612
12 SASI_Hs01_00053479 predicted 1325
13 SASI_Hs01_00053486 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051790 predicted 1111
2 SASI_Rn01_00051791 predicted 238
3 SASI_Rn01_00051792 predicted 874
4 SASI_Rn01_00051793 predicted 532
5 SASI_Rn01_00051794 predicted 527
6 SASI_Rn01_00051795 predicted 487
7 SASI_Rn01_00051796 predicted 231
8 SASI_Rn01_00051797 predicted 817
9 SASI_Rn01_00051798 predicted 217
10 SASI_Rn02_00262208 predicted 301
11 SASI_Rn01_00051799 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131481 predicted 1131
2 SASI_Mm01_00131483 predicted 1115
3 SASI_Mm01_00131484 predicted 1230
4 SASI_Mm01_00131485 predicted 581
5 SASI_Mm01_00131486 predicted 1264
6 SASI_Mm01_00131487 predicted 556
7 SASI_Mm01_00131488 predicted 541
8 SASI_Mm01_00131489 predicted 939
9 SASI_Mm01_00131490 predicted 644
10 SASI_Mm02_00313184 predicted 703
11 SASI_Mm01_00131482 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005266
GJA5 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 5, 40kDa
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005266.5-309s21c1
Sequence:CCGGGGCTGATTTCCGGTGTGATACCTCGAGGTATCACACCGGAAATCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005266.5-1093s21c1
Sequence:CCGGGGTTTCATCCAGGTTCGTTATCTCGAGATAACGAACCTGGATGAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-630s1c1
Sequence:CCGGCCAGTACTTCATCTACGGAATCTCGAGATTCCGTAGATGAAGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-970s1c1
Sequence:CCGGAGCAATAATATGGCCTCCCAACTCGAGTTGGGAGGCCATATTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-1122s1c1
Sequence:CCGGCCATGGCTATCATAGTGACAACTCGAGTTGTCACTATGATAGCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-918s1c1
Sequence:CCGGCTTTAATCAGTGCCTGGAGAACTCGAGTTCTCCAGGCACTGATTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005266
GJA5 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 5, 40kDa
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005266.5-309s21c1
Sequence:CCGGGGCTGATTTCCGGTGTGATACCTCGAGGTATCACACCGGAAATCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005266.5-1093s21c1
Sequence:CCGGGGTTTCATCCAGGTTCGTTATCTCGAGATAACGAACCTGGATGAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-630s1c1
Sequence:CCGGCCAGTACTTCATCTACGGAATCTCGAGATTCCGTAGATGAAGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-970s1c1
Sequence:CCGGAGCAATAATATGGCCTCCCAACTCGAGTTGGGAGGCCATATTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-1122s1c1
Sequence:CCGGCCATGGCTATCATAGTGACAACTCGAGTTGTCACTATGATAGCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-918s1c1
Sequence:CCGGCTTTAATCAGTGCCTGGAGAACTCGAGTTCTCCAGGCACTGATTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005266
GJA5 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 5, 40kDa
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005266.5-309s21c1
Sequence:CCGGGGCTGATTTCCGGTGTGATACCTCGAGGTATCACACCGGAAATCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005266.5-1093s21c1
Sequence:CCGGGGTTTCATCCAGGTTCGTTATCTCGAGATAACGAACCTGGATGAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-630s1c1
Sequence:CCGGCCAGTACTTCATCTACGGAATCTCGAGATTCCGTAGATGAAGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-970s1c1
Sequence:CCGGAGCAATAATATGGCCTCCCAACTCGAGTTGGGAGGCCATATTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-1122s1c1
Sequence:CCGGCCATGGCTATCATAGTGACAACTCGAGTTGTCACTATGATAGCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005266.4-918s1c1
Sequence:CCGGCTTTAATCAGTGCCTGGAGAACTCGAGTTCTCCAGGCACTGATTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008121
GJA5 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 5, 40kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-1042s1c1
Sequence:CCGGCCACATGCACTATAGCCAGAACTCGAGTTCTGGCTATAGTGCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-428s1c1
Sequence:CCGGCGGGATGCTGAGAAAGCTAAACTCGAGTTTAGCTTTCTCAGCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-896s1c1
Sequence:CCGGCCTGACTTCAATCAGTGCCTACTCGAGTAGGCACTGATTGAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-707s1c1
Sequence:CCGGACGGAGAAGAATGTCTTCATTCTCGAGAATGAAGACATTCTTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-264s1c1
Sequence:CCGGGCGATACCATTCAGCCTGGTTCTCGAGAACCAGGCTGAATGGTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008121
GJA5 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 5, 40kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-1042s1c1
Sequence:CCGGCCACATGCACTATAGCCAGAACTCGAGTTCTGGCTATAGTGCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-428s1c1
Sequence:CCGGCGGGATGCTGAGAAAGCTAAACTCGAGTTTAGCTTTCTCAGCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-896s1c1
Sequence:CCGGCCTGACTTCAATCAGTGCCTACTCGAGTAGGCACTGATTGAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-707s1c1
Sequence:CCGGACGGAGAAGAATGTCTTCATTCTCGAGAATGAAGACATTCTTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-264s1c1
Sequence:CCGGGCGATACCATTCAGCCTGGTTCTCGAGAACCAGGCTGAATGGTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008121
GJA5 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 5, 40kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-1042s1c1
Sequence:CCGGCCACATGCACTATAGCCAGAACTCGAGTTCTGGCTATAGTGCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-428s1c1
Sequence:CCGGCGGGATGCTGAGAAAGCTAAACTCGAGTTTAGCTTTCTCAGCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-896s1c1
Sequence:CCGGCCTGACTTCAATCAGTGCCTACTCGAGTAGGCACTGATTGAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-707s1c1
Sequence:CCGGACGGAGAAGAATGTCTTCATTCTCGAGAATGAAGACATTCTTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008121.2-264s1c1
Sequence:CCGGGCGATACCATTCAGCCTGGTTCTCGAGAACCAGGCTGAATGGTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)