EMAIL THIS PAGE TO A FRIEND

GJA8

gap junction protein, alpha 8, 50kDa

51 Gene Product Result for
Synonyms: CAE CAE1 CTRCT1 CX50 CZP1 MP70
UniProtKB ID: P48165, A7L5M5, Q5VVN9, Q9NP25
Gene ID:
Human(2703) Summary: This gene encodes a transmembrane connexin protein that is necessary for lens growth and maturation of lens fiber cells. The encoded protein is a component of gap junction channels and functions in a calcium and pH-dependent manner. Mutations in this gene have been associated with zonular pulverulent cataracts, nuclear progressive cataracts, and cataract-microcornea syndrome. [provided by RefSeq, Dec 2009]
Mouse(14616) gap junction protein, alpha 8
Rat(29601) gap junction protein, alpha 8
chicken(395846) gap junction protein, alpha 8, 50kDa
cow(524042) gap junction protein, alpha 8, 50kDa
domestic cat(101096160) gap junction protein, alpha 8, 50kDa
dog(483156) gap junction protein, alpha 8, 50kDa
sheep(100170231) gap junction protein, alpha 8, 50kDa
domestic guinea pig(100729504) gap junction protein, alpha 8, 50kDa
naked mole-rat(101726421) gap junction protein, alpha 8, 50kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005267 Rosetta Predictions human pricing
NM_153465 Rosetta Predictions rat pricing
NM_008123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339307 predicted 932
2 SASI_Hs01_00082788 predicted 545
3 SASI_Hs01_00082790 predicted 946
4 SASI_Hs01_00082791 predicted 822
5 SASI_Hs01_00082792 predicted 493
6 SASI_Hs01_00082793 predicted 535
7 SASI_Hs01_00082794 predicted 503
8 SASI_Hs01_00082795 predicted 1119
9 SASI_Hs01_00082796 predicted 708
10 SASI_Hs01_00082797 predicted 703
11 SASI_Hs01_00082789 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268968 predicted 1375
2 SASI_Rn02_00268969 predicted 588
3 SASI_Rn02_00268970 predicted 1384
4 SASI_Rn01_00117944 predicted 546
5 SASI_Rn01_00117945 predicted 662
6 SASI_Rn01_00117947 predicted 908
7 SASI_Rn01_00117949 predicted 935
8 SASI_Rn02_00268971 predicted 1288
9 SASI_Rn02_00268972 predicted 267
10 SASI_Rn02_00268973 predicted 1381
11 SASI_Rn01_00117942 predicted 495
12 SASI_Rn01_00117943 predicted 462
13 SASI_Rn01_00117946 predicted 785
14 SASI_Rn01_00117948 predicted 971
15 SASI_Rn01_00117950 predicted 769
16 SASI_Rn01_00117951 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052782 predicted 958
2 SASI_Mm01_00052783 predicted 910
3 SASI_Mm01_00052784 predicted 1013
4 SASI_Mm01_00052785 predicted 521
5 SASI_Mm01_00052786 predicted 581
6 SASI_Mm01_00052787 predicted 899
7 SASI_Mm01_00052788 predicted 537
8 SASI_Mm01_00052789 predicted 855
9 SASI_Mm01_00052790 predicted 649
10 SASI_Mm01_00052791 predicted 925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005267
GJA8 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 8, 50kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-200s21c1
Sequence:CCGGATCCGACTTCGTGTGCAACACCTCGAGGTGTTGCACACGAAGTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-1328s21c1
Sequence:CCGGAGCCAGGTCAGACGATCTAACCTCGAGGTTAGATCGTCTGACCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-1213s21c1
Sequence:CCGGAGTCGGAGAAGGTGTCAAAGCCTCGAGGCTTTGACACCTTCTCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-507s1c1
Sequence:CCGGGACCTACATCTGCCACATCATCTCGAGATGATGTGGCAGATGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-1187s1c1
Sequence:CCGGGAGTGGATAAGGAGGGTGAAACTCGAGTTTCACCCTCCTTATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-847s1c1
Sequence:CCGGGCCAAGGGCTATCAGCTTCTACTCGAGTAGAAGCTGATAGCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-945s1c1
Sequence:CCGGGCCTTTCAATCAGTTCGAGGACTCGAGTCCTCGAACTGATTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-705s1c1
Sequence:CCGGGTCCCTATTCCTCAACGTGATCTCGAGATCACGTTGAGGAATAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-847s21c1
Sequence:CCGGGCTATCAGCTCCTAGAAGAAGCTCGAGCTTCTTCTAGGAGCTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005267
GJA8 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 8, 50kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-200s21c1
Sequence:CCGGATCCGACTTCGTGTGCAACACCTCGAGGTGTTGCACACGAAGTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-1328s21c1
Sequence:CCGGAGCCAGGTCAGACGATCTAACCTCGAGGTTAGATCGTCTGACCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-1213s21c1
Sequence:CCGGAGTCGGAGAAGGTGTCAAAGCCTCGAGGCTTTGACACCTTCTCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-507s1c1
Sequence:CCGGGACCTACATCTGCCACATCATCTCGAGATGATGTGGCAGATGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-1187s1c1
Sequence:CCGGGAGTGGATAAGGAGGGTGAAACTCGAGTTTCACCCTCCTTATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-847s1c1
Sequence:CCGGGCCAAGGGCTATCAGCTTCTACTCGAGTAGAAGCTGATAGCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-945s1c1
Sequence:CCGGGCCTTTCAATCAGTTCGAGGACTCGAGTCCTCGAACTGATTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-705s1c1
Sequence:CCGGGTCCCTATTCCTCAACGTGATCTCGAGATCACGTTGAGGAATAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-847s21c1
Sequence:CCGGGCTATCAGCTCCTAGAAGAAGCTCGAGCTTCTTCTAGGAGCTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005267
GJA8 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 8, 50kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-200s21c1
Sequence:CCGGATCCGACTTCGTGTGCAACACCTCGAGGTGTTGCACACGAAGTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-1328s21c1
Sequence:CCGGAGCCAGGTCAGACGATCTAACCTCGAGGTTAGATCGTCTGACCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-1213s21c1
Sequence:CCGGAGTCGGAGAAGGTGTCAAAGCCTCGAGGCTTTGACACCTTCTCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-507s1c1
Sequence:CCGGGACCTACATCTGCCACATCATCTCGAGATGATGTGGCAGATGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-1187s1c1
Sequence:CCGGGAGTGGATAAGGAGGGTGAAACTCGAGTTTCACCCTCCTTATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-847s1c1
Sequence:CCGGGCCAAGGGCTATCAGCTTCTACTCGAGTAGAAGCTGATAGCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-945s1c1
Sequence:CCGGGCCTTTCAATCAGTTCGAGGACTCGAGTCCTCGAACTGATTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005267.2-705s1c1
Sequence:CCGGGTCCCTATTCCTCAACGTGATCTCGAGATCACGTTGAGGAATAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005267.4-847s21c1
Sequence:CCGGGCTATCAGCTCCTAGAAGAAGCTCGAGCTTCTTCTAGGAGCTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008123
GJA8 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 8, 50kDa
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-704s21c1
Sequence:CCGGCTTCATCCTCTTCATGTTATCCTCGAGGATAACATGAAGAGGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-586s21c1
Sequence:CCGGTCATCGTGGGCCATTACTTCCCTCGAGGGAAGTAATGGCCCACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-908s21c1
Sequence:CCGGGAAGATCGTATCACACTATTTCTCGAGAAATAGTGTGATACGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-556s21c1
Sequence:CCGGTCATCTTCAAGACCCTCTTTGCTCGAGCAAAGAGGGTCTTGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-1020s21c1
Sequence:CCGGGCAGATATGTCACGGAGTTACCTCGAGGTAACTCCGTGACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-325s21c1
Sequence:CCGGTCTCCACTCCATCGCTGATGTCTCGAGACATCAGCGATGGAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-838s21c1
Sequence:CCGGAGAAGTCCCTCCACTCCATTGCTCGAGCAATGGAGTGGAGGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-586s1c1
Sequence:CCGGCCCAATGTGGTAGACTGCTTTCTCGAGAAAGCAGTCTACCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-42s1c1
Sequence:CCGGGAATGAGCACTCCACTGTCATCTCGAGATGACAGTGGAGTGCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-1162s1c1
Sequence:CCGGGATGAGAAAGAAGAGCTGCAACTCGAGTTGCAGCTCTTCTTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-468s1c1
Sequence:CCGGGACCTATGTCTGCCACATCATCTCGAGATGATGTGGCAGACATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-843s1c1
Sequence:CCGGCGTATCACACTATTTCCCTTTCTCGAGAAAGGGAAATAGTGTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008123
GJA8 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 8, 50kDa
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-704s21c1
Sequence:CCGGCTTCATCCTCTTCATGTTATCCTCGAGGATAACATGAAGAGGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-586s21c1
Sequence:CCGGTCATCGTGGGCCATTACTTCCCTCGAGGGAAGTAATGGCCCACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-908s21c1
Sequence:CCGGGAAGATCGTATCACACTATTTCTCGAGAAATAGTGTGATACGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-556s21c1
Sequence:CCGGTCATCTTCAAGACCCTCTTTGCTCGAGCAAAGAGGGTCTTGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-1020s21c1
Sequence:CCGGGCAGATATGTCACGGAGTTACCTCGAGGTAACTCCGTGACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-325s21c1
Sequence:CCGGTCTCCACTCCATCGCTGATGTCTCGAGACATCAGCGATGGAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-838s21c1
Sequence:CCGGAGAAGTCCCTCCACTCCATTGCTCGAGCAATGGAGTGGAGGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-586s1c1
Sequence:CCGGCCCAATGTGGTAGACTGCTTTCTCGAGAAAGCAGTCTACCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-42s1c1
Sequence:CCGGGAATGAGCACTCCACTGTCATCTCGAGATGACAGTGGAGTGCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-1162s1c1
Sequence:CCGGGATGAGAAAGAAGAGCTGCAACTCGAGTTGCAGCTCTTCTTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-468s1c1
Sequence:CCGGGACCTATGTCTGCCACATCATCTCGAGATGATGTGGCAGACATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-843s1c1
Sequence:CCGGCGTATCACACTATTTCCCTTTCTCGAGAAAGGGAAATAGTGTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008123
GJA8 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 8, 50kDa
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-704s21c1
Sequence:CCGGCTTCATCCTCTTCATGTTATCCTCGAGGATAACATGAAGAGGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-586s21c1
Sequence:CCGGTCATCGTGGGCCATTACTTCCCTCGAGGGAAGTAATGGCCCACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-908s21c1
Sequence:CCGGGAAGATCGTATCACACTATTTCTCGAGAAATAGTGTGATACGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-556s21c1
Sequence:CCGGTCATCTTCAAGACCCTCTTTGCTCGAGCAAAGAGGGTCTTGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-1020s21c1
Sequence:CCGGGCAGATATGTCACGGAGTTACCTCGAGGTAACTCCGTGACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-325s21c1
Sequence:CCGGTCTCCACTCCATCGCTGATGTCTCGAGACATCAGCGATGGAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008123.2-838s21c1
Sequence:CCGGAGAAGTCCCTCCACTCCATTGCTCGAGCAATGGAGTGGAGGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-586s1c1
Sequence:CCGGCCCAATGTGGTAGACTGCTTTCTCGAGAAAGCAGTCTACCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-42s1c1
Sequence:CCGGGAATGAGCACTCCACTGTCATCTCGAGATGACAGTGGAGTGCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-1162s1c1
Sequence:CCGGGATGAGAAAGAAGAGCTGCAACTCGAGTTGCAGCTCTTCTTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-468s1c1
Sequence:CCGGGACCTATGTCTGCCACATCATCTCGAGATGATGTGGCAGACATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008123.1-843s1c1
Sequence:CCGGCGTATCACACTATTTCCCTTTCTCGAGAAAGGGAAATAGTGTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks