EMAIL THIS PAGE TO A FRIEND

GJA9

gap junction protein, alpha 9, 59kDa

25 Gene Product Result for
Synonyms: CX58 CX59 GJA10
UniProtKB ID: P57773, B2R722, B3KVQ2, Q5TA63, Q96KG0
Gene ID:
Human(81025) Summary: Connexins, such as GJA9, are involved in the formation of gap junctions, intercellular conduits that directly connect the cytoplasms of contacting cells. Each gap junction channel is formed by docking of 2 hemichannels, each of which contains 6 connexin subunits (Sohl et al., 2003 [PubMed 12881038]
naked mole-rat(101727504) gap junction protein, alpha 9, 59kDa
domestic guinea pig(100723046) gap junction protein, alpha 9, 59kDa
sheep(101117710) gap junction protein, alpha 9, 59kDa
chicken(100859395) gap junction protein, alpha 9, 59kDa
cow(100848695) gap junction protein, alpha 9, 59kDa
Horse(100054422) gap junction protein, alpha 9, 59kDa
domestic cat(101094194) gap junction protein, alpha 9, 59kDa
dog(100684742) gap junction protein, delta 2, 36kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030772 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114271 MISSION® esiRNA esiRNA human GJA9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030772 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210041 predicted 732
2 SASI_Hs01_00210042 predicted 922
3 SASI_Hs01_00210043 predicted 1510
4 SASI_Hs01_00210044 predicted 1760
5 SASI_Hs01_00210045 predicted 1429
6 SASI_Hs01_00210046 predicted 1270
7 SASI_Hs01_00210047 predicted 641
8 SASI_Hs02_00358315 predicted 280
9 SASI_Hs01_00210048 predicted 607
10 SASI_Hs01_00210049 predicted 743
11 SASI_Hs01_00210040 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030772
GJA9 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, alpha 9, 59kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-825s1c1
Sequence:CCGGGCCACCCGTGTCCAAATATAACTCGAGTTATATTTGGACACGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-1707s1c1
Sequence:CCGGGAACCTGTAATAATCCTGTTTCTCGAGAAACAGGATTATTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-574s1c1
Sequence:CCGGGCAAAGGATGAAAGCTCAGTTCTCGAGAACTGAGCTTTCATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-1254s1c1
Sequence:CCGGCCACACTTAGTACTAGTTGTACTCGAGTACAACTAGTACTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030772.3-823s21c1
Sequence:CCGGTTCACTTAGAGCCGCTATTTACTCGAGTAAATAGCGGCTCTAAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-350s1c2
Sequence:CCGGCGAATGCTTGTTCTGGGTGTACTCGAGTACACCCAGAACAAGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030772.3-1364s21c1
Sequence:CCGGACTTAATGGTAACCAGTTAATCTCGAGATTAACTGGTTACCATTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030772
GJA9 MISSION shRNA shRNA Plasmid DNA
gap junction protein, alpha 9, 59kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-825s1c1
Sequence:CCGGGCCACCCGTGTCCAAATATAACTCGAGTTATATTTGGACACGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-1707s1c1
Sequence:CCGGGAACCTGTAATAATCCTGTTTCTCGAGAAACAGGATTATTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-574s1c1
Sequence:CCGGGCAAAGGATGAAAGCTCAGTTCTCGAGAACTGAGCTTTCATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-1254s1c1
Sequence:CCGGCCACACTTAGTACTAGTTGTACTCGAGTACAACTAGTACTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030772.3-823s21c1
Sequence:CCGGTTCACTTAGAGCCGCTATTTACTCGAGTAAATAGCGGCTCTAAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-350s1c2
Sequence:CCGGCGAATGCTTGTTCTGGGTGTACTCGAGTACACCCAGAACAAGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030772.3-1364s21c1
Sequence:CCGGACTTAATGGTAACCAGTTAATCTCGAGATTAACTGGTTACCATTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030772
GJA9 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, alpha 9, 59kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-825s1c1
Sequence:CCGGGCCACCCGTGTCCAAATATAACTCGAGTTATATTTGGACACGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-1707s1c1
Sequence:CCGGGAACCTGTAATAATCCTGTTTCTCGAGAAACAGGATTATTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-574s1c1
Sequence:CCGGGCAAAGGATGAAAGCTCAGTTCTCGAGAACTGAGCTTTCATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-1254s1c1
Sequence:CCGGCCACACTTAGTACTAGTTGTACTCGAGTACAACTAGTACTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030772.3-823s21c1
Sequence:CCGGTTCACTTAGAGCCGCTATTTACTCGAGTAAATAGCGGCTCTAAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030772.2-350s1c2
Sequence:CCGGCGAATGCTTGTTCTGGGTGTACTCGAGTACACCCAGAACAAGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030772.3-1364s21c1
Sequence:CCGGACTTAATGGTAACCAGTTAATCTCGAGATTAACTGGTTACCATTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks