EMAIL THIS PAGE TO A FRIEND

GJB3

gap junction protein, beta 3, 31kDa

66 Gene Product Result for
Synonyms: CX31 DFNA2 DFNA2B EKV
UniProtKB ID: O75712, B2R790, Q2TAZ8
Gene ID:
Human(2707) Summary: This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene can cause non-syndromic deafness or erythrokeratodermia variabilis, a skin disorder. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(14620) gap junction protein, beta 3
Rat(29585) gap junction protein, beta 3
chicken(101665232) gap junction protein, beta 3, 31kDa
cow(539935) gap junction protein, beta 3, 31kDa
domestic cat(101083782) gap junction protein, beta 3, 31kDa
dog(482486) gap junction protein, beta 3, 31kDa
chicken(101748282) gap junction protein, beta 3, 31kDa
sheep(101107396) gap junction protein, beta 3, 31kDa
domestic guinea pig(100734354) gap junction protein, beta 3, 31kDa
naked mole-rat(101704921) gap junction protein, beta 3, 31kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024009 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005752 Rosetta Predictions human pricing
NM_024009 Rosetta Predictions human pricing
NM_019240 Rosetta Predictions rat pricing
NM_008126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119156 predicted 1410
2 SASI_Hs01_00119158 predicted 1180
3 SASI_Hs01_00119159 predicted 1130
4 SASI_Hs01_00119160 predicted 1247
5 SASI_Hs01_00119161 predicted 336
6 SASI_Hs01_00119162 predicted 534
7 SASI_Hs02_00305025 predicted 760
8 SASI_Hs01_00119163 predicted 1060
9 SASI_Hs01_00119164 predicted 1239
10 SASI_Hs01_00119165 predicted 395
11 SASI_Hs01_00119157 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172796 predicted 1860
2 SASI_Hs01_00172798 predicted 1638
3 SASI_Hs01_00172799 predicted 1580
4 SASI_Hs01_00172800 predicted 1707
5 SASI_Hs01_00172801 predicted 793
6 SASI_Hs01_00172802 predicted 994
7 SASI_Hs02_00356426 predicted 1215
8 SASI_Hs01_00172803 predicted 1523
9 SASI_Hs01_00172804 predicted 1695
10 SASI_Hs01_00172805 predicted 851
11 SASI_Hs01_00172797 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058774 predicted 323
2 SASI_Rn01_00058775 predicted 381
3 SASI_Rn01_00058776 predicted 253
4 SASI_Rn01_00058778 predicted 389
5 SASI_Rn01_00058779 predicted 407
6 SASI_Rn02_00262112 predicted 414
7 SASI_Rn01_00058781 predicted 478
8 SASI_Rn02_00262113 predicted 255
9 SASI_Rn01_00058782 predicted 586
10 SASI_Rn02_00262114 predicted 386
11 SASI_Rn01_00058777 predicted 384
12 SASI_Rn01_00058780 predicted 423
13 SASI_Rn01_00058783 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150255 predicted 986
2 SASI_Mm01_00150256 predicted 1097
3 SASI_Mm01_00150258 predicted 1371
4 SASI_Mm02_00313186 predicted 1106
5 SASI_Mm01_00150259 predicted 294
6 SASI_Mm01_00150260 predicted 1068
7 SASI_Mm01_00150261 predicted 502
8 SASI_Mm01_00150262 predicted 1069
9 SASI_Mm01_00150264 predicted 1024
10 SASI_Mm02_00313187 predicted 996
11 SASI_Mm01_00150257 predicted 1118
12 SASI_Mm01_00150263 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024009
GJB3 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 3, 31kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024009.2-1590s21c1
Sequence:CCGGGTCTAGCCGGGTATAGGTAACCTCGAGGTTACCTATACCCGGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024009.2-645s21c1
Sequence:CCGGGAGCGGTGTGAACAAGTACTCCTCGAGGAGTACTTGTTCACACCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024009.2-1645s21c1
Sequence:CCGGACTTTGAAACAAGCGAATTAACTCGAGTTAATTCGCTTGTTTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1319s1c1
Sequence:CCGGCGTCTGCTACGACAACTACTTCTCGAGAAGTAGTTGTCGTAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1900s1c1
Sequence:CCGGGCAATAACAAGCTGCAGGCTTCTCGAGAAGCCTGCAGCTTGTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1668s1c1
Sequence:CCGGGCCCGACCTACCGAGAAGAAACTCGAGTTTCTTCTCGGTAGGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1585s1c1
Sequence:CCGGCTCTCTGGCATGGCTTCAATACTCGAGTATTGAAGCCATGCCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1523s1c1
Sequence:CCGGCTACCTGTTCAGCCTCATCTTCTCGAGAAGATGAGGCTGAACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024009
GJB3 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 3, 31kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024009.2-1590s21c1
Sequence:CCGGGTCTAGCCGGGTATAGGTAACCTCGAGGTTACCTATACCCGGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024009.2-645s21c1
Sequence:CCGGGAGCGGTGTGAACAAGTACTCCTCGAGGAGTACTTGTTCACACCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024009.2-1645s21c1
Sequence:CCGGACTTTGAAACAAGCGAATTAACTCGAGTTAATTCGCTTGTTTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1319s1c1
Sequence:CCGGCGTCTGCTACGACAACTACTTCTCGAGAAGTAGTTGTCGTAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1900s1c1
Sequence:CCGGGCAATAACAAGCTGCAGGCTTCTCGAGAAGCCTGCAGCTTGTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1668s1c1
Sequence:CCGGGCCCGACCTACCGAGAAGAAACTCGAGTTTCTTCTCGGTAGGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1585s1c1
Sequence:CCGGCTCTCTGGCATGGCTTCAATACTCGAGTATTGAAGCCATGCCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1523s1c1
Sequence:CCGGCTACCTGTTCAGCCTCATCTTCTCGAGAAGATGAGGCTGAACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024009
GJB3 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 3, 31kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024009.2-1590s21c1
Sequence:CCGGGTCTAGCCGGGTATAGGTAACCTCGAGGTTACCTATACCCGGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024009.2-645s21c1
Sequence:CCGGGAGCGGTGTGAACAAGTACTCCTCGAGGAGTACTTGTTCACACCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024009.2-1645s21c1
Sequence:CCGGACTTTGAAACAAGCGAATTAACTCGAGTTAATTCGCTTGTTTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1319s1c1
Sequence:CCGGCGTCTGCTACGACAACTACTTCTCGAGAAGTAGTTGTCGTAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1900s1c1
Sequence:CCGGGCAATAACAAGCTGCAGGCTTCTCGAGAAGCCTGCAGCTTGTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1668s1c1
Sequence:CCGGGCCCGACCTACCGAGAAGAAACTCGAGTTTCTTCTCGGTAGGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1585s1c1
Sequence:CCGGCTCTCTGGCATGGCTTCAATACTCGAGTATTGAAGCCATGCCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024009.1-1523s1c1
Sequence:CCGGCTACCTGTTCAGCCTCATCTTCTCGAGAAGATGAGGCTGAACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008126
VALIDATED
GJB3 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 3, 31kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-661s21c1
Sequence:CCGGCCACGGAGAAGAAGGTCTTTACTCGAGTAAAGACCTTCTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-521s21c1
Sequence:CCGGCCTCATCTTCAAGCTCATCATCTCGAGATGATGAGCTTGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008126.1-1077s21c1
Sequence:CCGGACCTGGTTTAGGTAGCATAACCTCGAGGTTATGCTACCTAAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-160s21c1
Sequence:CCGGACCAGTACTCCACGGCATTTGCTCGAGCAAATGCCGTGGAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-366s21c1
Sequence:CCGGTTCGTCACGTGTCCGTCTATGCTCGAGCATAGACGGACACGTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-191s1c1
Sequence:CCGGGCTGTCAGTAGTGTTCGTCTTCTCGAGAAGACGAACACTACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008126.1-764s1c1
Sequence:CCGGGCGAGGCATAAGCAAGGGCAACTCGAGTTGCCCTTGCTTATGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008126.1-707s1c1
Sequence:CCGGCGTCTGCATTATTCTCACCATCTCGAGATGGTGAGAATAATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-521s1c1
Sequence:CCGGCCTCATCTTCAAGCTCATCATCTCGAGATGATGAGCTTGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-305s1c1
Sequence:CCGGCGTGTGCTATGACAACTTCTTCTCGAGAAGAAGTTGTCATAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008126
VALIDATED
GJB3 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 3, 31kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-661s21c1
Sequence:CCGGCCACGGAGAAGAAGGTCTTTACTCGAGTAAAGACCTTCTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-521s21c1
Sequence:CCGGCCTCATCTTCAAGCTCATCATCTCGAGATGATGAGCTTGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008126.1-1077s21c1
Sequence:CCGGACCTGGTTTAGGTAGCATAACCTCGAGGTTATGCTACCTAAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-160s21c1
Sequence:CCGGACCAGTACTCCACGGCATTTGCTCGAGCAAATGCCGTGGAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-366s21c1
Sequence:CCGGTTCGTCACGTGTCCGTCTATGCTCGAGCATAGACGGACACGTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-191s1c1
Sequence:CCGGGCTGTCAGTAGTGTTCGTCTTCTCGAGAAGACGAACACTACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008126.1-764s1c1
Sequence:CCGGGCGAGGCATAAGCAAGGGCAACTCGAGTTGCCCTTGCTTATGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008126.1-707s1c1
Sequence:CCGGCGTCTGCATTATTCTCACCATCTCGAGATGGTGAGAATAATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-521s1c1
Sequence:CCGGCCTCATCTTCAAGCTCATCATCTCGAGATGATGAGCTTGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-305s1c1
Sequence:CCGGCGTGTGCTATGACAACTTCTTCTCGAGAAGAAGTTGTCATAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008126
VALIDATED
GJB3 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 3, 31kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-661s21c1
Sequence:CCGGCCACGGAGAAGAAGGTCTTTACTCGAGTAAAGACCTTCTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-521s21c1
Sequence:CCGGCCTCATCTTCAAGCTCATCATCTCGAGATGATGAGCTTGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008126.1-1077s21c1
Sequence:CCGGACCTGGTTTAGGTAGCATAACCTCGAGGTTATGCTACCTAAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-160s21c1
Sequence:CCGGACCAGTACTCCACGGCATTTGCTCGAGCAAATGCCGTGGAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008126.1-366s21c1
Sequence:CCGGTTCGTCACGTGTCCGTCTATGCTCGAGCATAGACGGACACGTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-191s1c1
Sequence:CCGGGCTGTCAGTAGTGTTCGTCTTCTCGAGAAGACGAACACTACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008126.1-764s1c1
Sequence:CCGGGCGAGGCATAAGCAAGGGCAACTCGAGTTGCCCTTGCTTATGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008126.1-707s1c1
Sequence:CCGGCGTCTGCATTATTCTCACCATCTCGAGATGGTGAGAATAATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-521s1c1
Sequence:CCGGCCTCATCTTCAAGCTCATCATCTCGAGATGATGAGCTTGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008126.1-305s1c1
Sequence:CCGGCGTGTGCTATGACAACTTCTTCTCGAGAAGAAGTTGTCATAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks