EMAIL THIS PAGE TO A FRIEND

GJB4

gap junction protein, beta 4, 30.3kDa

51 Gene Product Result for
Synonyms: CX30.3 EKV
UniProtKB ID: Q9NTQ9, B3KQ82
Gene ID:
Human(127534) Summary: This gene encodes a transmembrane connexin protein that is a component of gap junctions. Mutations in this gene have been associated with erythrokeratodermia variabilis, progressive symmetric erythrokeratoderma and hearing impairment. [provided by RefSeq, Dec 2009]
Mouse(14621) gap junction protein, beta 4
Rat(117055) gap junction protein, beta 4
naked mole-rat(101704563) gap junction protein, beta 4, 30.3kDa
domestic guinea pig(100735468) gap junction protein, beta 4, 30.3kDa
sheep(101107144) gap junction protein, beta 4, 30.3kDa
dog(482487) gap junction protein, beta 4, 30.3kDa
cow(100140553) gap junction protein, beta 4, 30.3kDa
domestic cat(101083529) gap junction protein, beta 4, 30.3kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153212 Rosetta Predictions human pricing
NM_053984 Rosetta Predictions rat pricing
NM_008127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231390 predicted 767
2 SASI_Hs01_00231391 predicted 492
3 SASI_Hs01_00231392 predicted 309
4 SASI_Hs01_00231393 predicted 458
5 SASI_Hs01_00231394 predicted 701
6 SASI_Hs01_00231395 predicted 492
7 SASI_Hs01_00231396 predicted 451
8 SASI_Hs01_00231397 predicted 383
9 SASI_Hs01_00231398 predicted 765
10 SASI_Hs02_00367072 predicted 500
11 SASI_Hs01_00231389 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091369 predicted 1592
2 SASI_Rn01_00091370 predicted 1467
3 SASI_Rn01_00091371 predicted 1161
4 SASI_Rn01_00091372 predicted 1061
5 SASI_Rn01_00091374 predicted 1462
6 SASI_Rn02_00266980 predicted 1031
7 SASI_Rn02_00266981 predicted 1354
8 SASI_Rn01_00091375 predicted 1214
9 SASI_Rn01_00091376 predicted 1207
10 SASI_Rn01_00091377 predicted 1541
11 SASI_Rn01_00091373 predicted 1199
12 SASI_Rn01_00091378 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089306 predicted 1199
2 SASI_Mm01_00089308 predicted 821
3 SASI_Mm02_00313188 predicted 1115
4 SASI_Mm01_00089309 predicted 1067
5 SASI_Mm01_00089310 predicted 635
6 SASI_Mm01_00089311 predicted 691
7 SASI_Mm01_00089312 predicted 1189
8 SASI_Mm01_00089313 predicted 764
9 SASI_Mm01_00089314 predicted 666
10 SASI_Mm01_00089315 predicted 889
11 SASI_Mm01_00089307 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153212
GJB4 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 4, 30.3kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153212.1-882s1c1
Sequence:CCGGTGCGAGATCAGCAGATAAGATCTCGAGATCTTATCTGCTGATCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-675s1c1
Sequence:CCGGGCTCAACCTCAGTGAAGTCTTCTCGAGAAGACTTCACTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-426s1c1
Sequence:CCGGGTACGACAACCTGAGCAAGAACTCGAGTTCTTGCTCAGGTTGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-588s1c1
Sequence:CCGGCCACACTGTGGACTGTTACATCTCGAGATGTAACAGTCCACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-531s1c1
Sequence:CCGGCCTCTACAAGGATTATGACATCTCGAGATGTCATAATCCTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153212.2-1151s21c1
Sequence:CCGGGATGCAGGTGGGTATCCATAACTCGAGTTATGGATACCCACCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153212.2-1390s21c1
Sequence:CCGGTGTATATGGCAACAGTATATGCTCGAGCATATACTGTTGCCATATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153212
GJB4 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 4, 30.3kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153212.1-882s1c1
Sequence:CCGGTGCGAGATCAGCAGATAAGATCTCGAGATCTTATCTGCTGATCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-675s1c1
Sequence:CCGGGCTCAACCTCAGTGAAGTCTTCTCGAGAAGACTTCACTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-426s1c1
Sequence:CCGGGTACGACAACCTGAGCAAGAACTCGAGTTCTTGCTCAGGTTGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-588s1c1
Sequence:CCGGCCACACTGTGGACTGTTACATCTCGAGATGTAACAGTCCACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-531s1c1
Sequence:CCGGCCTCTACAAGGATTATGACATCTCGAGATGTCATAATCCTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153212.2-1151s21c1
Sequence:CCGGGATGCAGGTGGGTATCCATAACTCGAGTTATGGATACCCACCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153212.2-1390s21c1
Sequence:CCGGTGTATATGGCAACAGTATATGCTCGAGCATATACTGTTGCCATATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153212
GJB4 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 4, 30.3kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153212.1-882s1c1
Sequence:CCGGTGCGAGATCAGCAGATAAGATCTCGAGATCTTATCTGCTGATCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-675s1c1
Sequence:CCGGGCTCAACCTCAGTGAAGTCTTCTCGAGAAGACTTCACTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-426s1c1
Sequence:CCGGGTACGACAACCTGAGCAAGAACTCGAGTTCTTGCTCAGGTTGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-588s1c1
Sequence:CCGGCCACACTGTGGACTGTTACATCTCGAGATGTAACAGTCCACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153212.1-531s1c1
Sequence:CCGGCCTCTACAAGGATTATGACATCTCGAGATGTCATAATCCTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153212.2-1151s21c1
Sequence:CCGGGATGCAGGTGGGTATCCATAACTCGAGTTATGGATACCCACCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153212.2-1390s21c1
Sequence:CCGGTGTATATGGCAACAGTATATGCTCGAGCATATACTGTTGCCATATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008127
GJB4 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 4, 30.3kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-753s1c1
Sequence:CCGGGCTTTCTCTATATCTTCCATTCTCGAGAATGGAAGATATAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-769s1c1
Sequence:CCGGCCATTGCATTTACAAGGACTACTCGAGTAGTCCTTGTAAATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-626s1c1
Sequence:CCGGGAAAGGAAACATCGCCTCAAACTCGAGTTTGAGGCGATGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008127.3-1266s21c1
Sequence:CCGGAGCAGGTCAGGTGGGAAACATCTCGAGATGTTTCCCACCTGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-823s21c1
Sequence:CCGGTACATCTTCCATTGCATTTACCTCGAGGTAAATGCAATGGAAGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-1182s21c1
Sequence:CCGGATGACCTGCAGGTATGGTTATCTCGAGATAACCATACCTGCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-1126s21c1
Sequence:CCGGGAGAGCGTGATCCTAACAAAGCTCGAGCTTTGTTAGGATCACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-953s21c1
Sequence:CCGGTGGTAGTCACGGCAGCCATTTCTCGAGAAATGGCTGCCGTGACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008127
GJB4 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 4, 30.3kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-753s1c1
Sequence:CCGGGCTTTCTCTATATCTTCCATTCTCGAGAATGGAAGATATAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-769s1c1
Sequence:CCGGCCATTGCATTTACAAGGACTACTCGAGTAGTCCTTGTAAATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-626s1c1
Sequence:CCGGGAAAGGAAACATCGCCTCAAACTCGAGTTTGAGGCGATGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008127.3-1266s21c1
Sequence:CCGGAGCAGGTCAGGTGGGAAACATCTCGAGATGTTTCCCACCTGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-823s21c1
Sequence:CCGGTACATCTTCCATTGCATTTACCTCGAGGTAAATGCAATGGAAGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-1182s21c1
Sequence:CCGGATGACCTGCAGGTATGGTTATCTCGAGATAACCATACCTGCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-1126s21c1
Sequence:CCGGGAGAGCGTGATCCTAACAAAGCTCGAGCTTTGTTAGGATCACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-953s21c1
Sequence:CCGGTGGTAGTCACGGCAGCCATTTCTCGAGAAATGGCTGCCGTGACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008127
GJB4 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 4, 30.3kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-753s1c1
Sequence:CCGGGCTTTCTCTATATCTTCCATTCTCGAGAATGGAAGATATAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-769s1c1
Sequence:CCGGCCATTGCATTTACAAGGACTACTCGAGTAGTCCTTGTAAATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008127.2-626s1c1
Sequence:CCGGGAAAGGAAACATCGCCTCAAACTCGAGTTTGAGGCGATGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008127.3-1266s21c1
Sequence:CCGGAGCAGGTCAGGTGGGAAACATCTCGAGATGTTTCCCACCTGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-823s21c1
Sequence:CCGGTACATCTTCCATTGCATTTACCTCGAGGTAAATGCAATGGAAGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-1182s21c1
Sequence:CCGGATGACCTGCAGGTATGGTTATCTCGAGATAACCATACCTGCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-1126s21c1
Sequence:CCGGGAGAGCGTGATCCTAACAAAGCTCGAGCTTTGTTAGGATCACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008127.3-953s21c1
Sequence:CCGGTGGTAGTCACGGCAGCCATTTCTCGAGAAATGGCTGCCGTGACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks