EMAIL THIS PAGE TO A FRIEND

GJB5

gap junction protein, beta 5, 31.1kDa

57 Gene Product Result for
Synonyms: CX31.1
UniProtKB ID: O95377, Q9UPA3
Gene ID:
Human(2709) Summary: This gene encodes a member of the beta-type (group I) connexin family. The encoded protein is a gap junction protein involved in intercellular communication related to epidermal differentiation and environmental sensing. This gene has been linked to non-small cell lung cancer. [provided by RefSeq, Nov 2012]
Mouse(14622) gap junction protein, beta 5
Rat(29586) gap junction protein, beta 5
chicken(428225) gap junction protein, beta 5, 31.1kDa
cow(524030) gap junction protein, beta 5, 31.1kDa
domestic cat(101083279) gap junction protein, beta 5, 31.1kDa
dog(482488) gap junction protein, beta 5, 31.1kDa
sheep(101106891) gap junction protein, beta 5, 31.1kDa
domestic guinea pig(100724383) gap junction protein, beta 5, 31.1kDa
naked mole-rat(101704215) gap junction protein, beta 5, 31.1kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005268 Rosetta Predictions human pricing
NM_019241 Rosetta Predictions rat pricing
NM_010291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010191 predicted 601
2 SASI_Hs02_00339308 predicted 1052
3 SASI_Hs01_00010193 predicted 274
4 SASI_Hs02_00339309 predicted 850
5 SASI_Hs02_00339310 predicted 1038
6 SASI_Hs02_00339311 predicted 486
7 SASI_Hs02_00339312 predicted 801
8 SASI_Hs01_00010195 predicted 238
9 SASI_Hs01_00010196 predicted 517
10 SASI_Hs01_00010197 predicted 235
11 SASI_Hs01_00010192 predicted 523
12 SASI_Hs01_00010194 predicted 593
13 SASI_Hs01_00010198 predicted 341
14 SASI_Hs01_00010199 predicted 790
15 SASI_Hs01_00010200 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102135 predicted 465
2 SASI_Rn01_00102136 predicted 258
3 SASI_Rn01_00102137 predicted 449
4 SASI_Rn01_00102138 predicted 397
5 SASI_Rn01_00102141 predicted 306
6 SASI_Rn01_00102142 predicted 574
7 SASI_Rn02_00262115 predicted 318
8 SASI_Rn01_00102144 predicted 480
9 SASI_Rn02_00262116 predicted 284
10 SASI_Rn02_00262117 predicted 381
11 SASI_Rn01_00102139 predicted 327
12 SASI_Rn01_00102140 predicted 387
13 SASI_Rn01_00102143 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165994 predicted 554
2 SASI_Mm01_00165995 predicted 1020
3 SASI_Mm01_00165996 predicted 1064
4 SASI_Mm01_00165997 predicted 609
5 SASI_Mm01_00165998 predicted 235
6 SASI_Mm01_00165999 predicted 765
7 SASI_Mm02_00318261 predicted 801
8 SASI_Mm01_00166000 predicted 1297
9 SASI_Mm01_00166001 predicted 287
10 SASI_Mm01_00166002 predicted 542
11 SASI_Mm01_00166003 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005268
GJB5 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 5, 31.1kDa
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005268.2-142s21c1
Sequence:CCGGCAAGTACTCCACAGCCTTTGGCTCGAGCCAAAGGCTGTGGAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005268.2-278s21c1
Sequence:CCGGTGCTCCAACGTCTGCTTTGATCTCGAGATCAAAGCAGACGTTGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005268.2-964s1c1
Sequence:CCGGGAGGCTCTAGCATCTCTCATACTCGAGTATGAGAGATGCTAGAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-813s1c1
Sequence:CCGGGCAAACAAGACGACCTCCTTTCTCGAGAAAGGAGGTCGTCTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-242s1c1
Sequence:CCGGCACAAGGACTTCGACTGCAATCTCGAGATTGCAGTCGAAGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-595s1c1
Sequence:CCGGCGCAGATCCATGTCCCAATATCTCGAGATATTGGGACATGGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005268
GJB5 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 5, 31.1kDa
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005268.2-142s21c1
Sequence:CCGGCAAGTACTCCACAGCCTTTGGCTCGAGCCAAAGGCTGTGGAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005268.2-278s21c1
Sequence:CCGGTGCTCCAACGTCTGCTTTGATCTCGAGATCAAAGCAGACGTTGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005268.2-964s1c1
Sequence:CCGGGAGGCTCTAGCATCTCTCATACTCGAGTATGAGAGATGCTAGAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-813s1c1
Sequence:CCGGGCAAACAAGACGACCTCCTTTCTCGAGAAAGGAGGTCGTCTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-242s1c1
Sequence:CCGGCACAAGGACTTCGACTGCAATCTCGAGATTGCAGTCGAAGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-595s1c1
Sequence:CCGGCGCAGATCCATGTCCCAATATCTCGAGATATTGGGACATGGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005268
GJB5 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 5, 31.1kDa
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005268.2-142s21c1
Sequence:CCGGCAAGTACTCCACAGCCTTTGGCTCGAGCCAAAGGCTGTGGAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005268.2-278s21c1
Sequence:CCGGTGCTCCAACGTCTGCTTTGATCTCGAGATCAAAGCAGACGTTGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005268.2-964s1c1
Sequence:CCGGGAGGCTCTAGCATCTCTCATACTCGAGTATGAGAGATGCTAGAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-813s1c1
Sequence:CCGGGCAAACAAGACGACCTCCTTTCTCGAGAAAGGAGGTCGTCTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-242s1c1
Sequence:CCGGCACAAGGACTTCGACTGCAATCTCGAGATTGCAGTCGAAGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005268.2-595s1c1
Sequence:CCGGCGCAGATCCATGTCCCAATATCTCGAGATATTGGGACATGGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010291
GJB5 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 5, 31.1kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-768s1c1
Sequence:CCGGGAGCTGATCTACCTAGTGATTCTCGAGAATCACTAGGTAGATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-495s1c1
Sequence:CCGGGAAGGTTACCTTTACCCGAATCTCGAGATTCGGGTAAAGGTAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-825s1c1
Sequence:CCGGCCCACTGCACATGCAAAGAATCTCGAGATTCTTTGCATGTGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-633s1c1
Sequence:CCGGCCTTCTATGGTCAAGTGCCATCTCGAGATGGCACTTGACCATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-605s1c1
Sequence:CCGGCCACGCATTCTATCCCAGATACTCGAGTATCTGGGATAGAATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010291
GJB5 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 5, 31.1kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-768s1c1
Sequence:CCGGGAGCTGATCTACCTAGTGATTCTCGAGAATCACTAGGTAGATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-495s1c1
Sequence:CCGGGAAGGTTACCTTTACCCGAATCTCGAGATTCGGGTAAAGGTAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-825s1c1
Sequence:CCGGCCCACTGCACATGCAAAGAATCTCGAGATTCTTTGCATGTGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-633s1c1
Sequence:CCGGCCTTCTATGGTCAAGTGCCATCTCGAGATGGCACTTGACCATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-605s1c1
Sequence:CCGGCCACGCATTCTATCCCAGATACTCGAGTATCTGGGATAGAATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010291
GJB5 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 5, 31.1kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-768s1c1
Sequence:CCGGGAGCTGATCTACCTAGTGATTCTCGAGAATCACTAGGTAGATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-495s1c1
Sequence:CCGGGAAGGTTACCTTTACCCGAATCTCGAGATTCGGGTAAAGGTAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-825s1c1
Sequence:CCGGCCCACTGCACATGCAAAGAATCTCGAGATTCTTTGCATGTGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-633s1c1
Sequence:CCGGCCTTCTATGGTCAAGTGCCATCTCGAGATGGCACTTGACCATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010291.2-605s1c1
Sequence:CCGGCCACGCATTCTATCCCAGATACTCGAGTATCTGGGATAGAATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks