EMAIL THIS PAGE TO A FRIEND

GJB6

gap junction protein, beta 6, 30kDa

94 Gene Product Result for
Synonyms: CX30 DFNA3 DFNA3B DFNB1B ECTD2 ED2 EDH HED HED2
Gene ID:
Human(10804) Summary: Gap junctions allow the transport of ions and metabolites between the cytoplasm of adjacent cells. They are formed by two hemichannels, made up of six connexin proteins assembled in groups. Each connexin protein has four transmembrane segments, two extracellular loops, a cytoplasmic loop formed between the two inner transmembrane segments, and the N- and C-terminus both being in the cytoplasm. The specificity of the gap junction is determined by which connexin proteins comprise the hemichannel. In the past, connexin protein names were based on their molecular weight, however the new nomenclature uses sequential numbers based on which form (alpha or beta) of the gap junction is present. This gene encodes one of the connexin proteins. Mutations in this gene have been found in some forms of deafness and in some families with hidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
Mouse(14623) gap junction protein, beta 6
Rat(84403) gap junction protein, beta 6
naked mole-rat(101709299) gap junction protein, beta 6, 30kDa
domestic guinea pig(100714609) gap junction protein, beta 6, 30kDa
sheep(101118368) gap junction protein, beta 6, 30kDa
chicken(395771) gap junction protein, beta 6, 30kDa
domestic cat(101082796) gap junction protein, beta 6, 30kDa
cow(508454) gap junction protein, beta 6, 30kDa
dog(100688824) gap junction protein, beta 6, 30kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006783 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088441 MISSION® esiRNA esiRNA human GJB6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110219 Rosetta Predictions human pricing
NM_001110220 Rosetta Predictions human pricing
NM_001110221 Rosetta Predictions human pricing
NM_006783 Rosetta Predictions human pricing
NM_053388 Rosetta Predictions rat pricing
NM_001010937 Rosetta Predictions mouse pricing
NM_008128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324875 predicted 1275
2 SASI_Hs02_00324876 predicted 1389
3 SASI_Hs02_00324877 predicted 1079
4 SASI_Hs02_00324878 predicted 846
5 SASI_Hs02_00324879 predicted 1350
6 SASI_Hs02_00324880 predicted 1356
7 SASI_Hs02_00324881 predicted 1304
8 SASI_Hs02_00324882 predicted 836
9 SASI_Hs02_00324883 predicted 1246
10 SASI_Hs02_00324884 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324885 predicted 1167
2 SASI_Hs02_00324886 predicted 1276
3 SASI_Hs02_00324887 predicted 965
4 SASI_Hs02_00324888 predicted 742
5 SASI_Hs02_00324889 predicted 1242
6 SASI_Hs02_00324890 predicted 1247
7 SASI_Hs02_00324891 predicted 1194
8 SASI_Hs02_00324892 predicted 729
9 SASI_Hs02_00324893 predicted 1130
10 SASI_Hs02_00324894 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324895 predicted 1048
2 SASI_Hs02_00324896 predicted 1152
3 SASI_Hs02_00324897 predicted 842
4 SASI_Hs02_00324898 predicted 610
5 SASI_Hs02_00324899 predicted 1113
6 SASI_Hs02_00324900 predicted 1120
7 SASI_Hs02_00324901 predicted 1071
8 SASI_Hs02_00324902 predicted 601
9 SASI_Hs02_00324903 predicted 1006
10 SASI_Hs02_00324904 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091788 predicted 1035
2 SASI_Hs01_00091789 predicted 1151
3 SASI_Hs01_00091790 predicted 837
4 SASI_Hs01_00091791 predicted 609
5 SASI_Hs01_00091793 predicted 1110
6 SASI_Hs01_00091794 predicted 1119
7 SASI_Hs01_00091795 predicted 1054
8 SASI_Hs01_00091796 predicted 592
9 SASI_Hs02_00342298 predicted 1000
10 SASI_Hs02_00342299 predicted 597
11 SASI_Hs01_00091787 predicted 1031
12 SASI_Hs01_00091792 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121295 predicted 558
2 SASI_Rn02_00265883 predicted 1326
3 SASI_Rn01_00121296 predicted 1206
4 SASI_Rn01_00121297 predicted 562
5 SASI_Rn01_00121298 predicted 1116
6 SASI_Rn01_00121299 predicted 1127
7 SASI_Rn01_00121301 predicted 1151
8 SASI_Rn01_00121302 predicted 286
9 SASI_Rn02_00265884 predicted 558
10 SASI_Rn01_00121303 predicted 888
11 SASI_Rn01_00121294 predicted 1336
12 SASI_Rn01_00121300 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198793 predicted 1331
2 SASI_Mm01_00198794 predicted 1204
3 SASI_Mm01_00198795 predicted 1207
4 SASI_Mm01_00198796 predicted 860
5 SASI_Mm01_00198797 predicted 869
6 SASI_Mm01_00198798 predicted 1331
7 SASI_Mm01_00198799 predicted 1197
8 SASI_Mm01_00198800 predicted 1180
9 SASI_Mm01_00198801 predicted 1391
10 SASI_Mm01_00198802 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071363 predicted 1179
2 SASI_Mm01_00071364 predicted 1052
3 SASI_Mm01_00071365 predicted 1058
4 SASI_Mm01_00071366 predicted 713
5 SASI_Mm01_00071367 predicted 719
6 SASI_Mm01_00071368 predicted 1183
7 SASI_Mm01_00071369 predicted 1043
8 SASI_Mm01_00071370 predicted 1028
9 SASI_Mm01_00071371 predicted 1232
10 SASI_Mm01_00071372 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006783
GJB6 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 6, 30kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006783.2-1187s1c1
Sequence:CCGGGCTCCATTCATACACAACGTACTCGAGTACGTTGTGTATGAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-801s1c1
Sequence:CCGGCCAACAGAGAAGACCGTGTTTCTCGAGAAACACGGTCTTCTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-913s1c1
Sequence:CCGGCAAAGAGAGCACAGACGCAAACTCGAGTTTGCGTCTGTGCTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-545s1c1
Sequence:CCGGGCACGAAACCACTCGCAAGTTCTCGAGAACTTGCGAGTGGTTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-690s1c1
Sequence:CCGGGCAGCCTTTATGTATGTGTTTCTCGAGAAACACATACATAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006783.4-622s21c1
Sequence:CCGGGTGGATCACAGTCATCTTTATCTCGAGATAAAGATGACTGTGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006783.4-1080s21c1
Sequence:CCGGACCTTGTTGACTGCTTTATTTCTCGAGAAATAAAGCAGTCAACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006783.4-1802s21c1
Sequence:CCGGTACACCACAAGTATCTAAATTCTCGAGAATTTAGATACTTGTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006783.4-1662s21c1
Sequence:CCGGCCAGGAATTGATACGTTTATTCTCGAGAATAAACGTATCAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006783
GJB6 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 6, 30kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006783.2-1187s1c1
Sequence:CCGGGCTCCATTCATACACAACGTACTCGAGTACGTTGTGTATGAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-801s1c1
Sequence:CCGGCCAACAGAGAAGACCGTGTTTCTCGAGAAACACGGTCTTCTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-913s1c1
Sequence:CCGGCAAAGAGAGCACAGACGCAAACTCGAGTTTGCGTCTGTGCTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-545s1c1
Sequence:CCGGGCACGAAACCACTCGCAAGTTCTCGAGAACTTGCGAGTGGTTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-690s1c1
Sequence:CCGGGCAGCCTTTATGTATGTGTTTCTCGAGAAACACATACATAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006783.4-622s21c1
Sequence:CCGGGTGGATCACAGTCATCTTTATCTCGAGATAAAGATGACTGTGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006783.4-1080s21c1
Sequence:CCGGACCTTGTTGACTGCTTTATTTCTCGAGAAATAAAGCAGTCAACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006783.4-1802s21c1
Sequence:CCGGTACACCACAAGTATCTAAATTCTCGAGAATTTAGATACTTGTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006783.4-1662s21c1
Sequence:CCGGCCAGGAATTGATACGTTTATTCTCGAGAATAAACGTATCAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006783
GJB6 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 6, 30kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006783.2-1187s1c1
Sequence:CCGGGCTCCATTCATACACAACGTACTCGAGTACGTTGTGTATGAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-801s1c1
Sequence:CCGGCCAACAGAGAAGACCGTGTTTCTCGAGAAACACGGTCTTCTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-913s1c1
Sequence:CCGGCAAAGAGAGCACAGACGCAAACTCGAGTTTGCGTCTGTGCTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-545s1c1
Sequence:CCGGGCACGAAACCACTCGCAAGTTCTCGAGAACTTGCGAGTGGTTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006783.2-690s1c1
Sequence:CCGGGCAGCCTTTATGTATGTGTTTCTCGAGAAACACATACATAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006783.4-622s21c1
Sequence:CCGGGTGGATCACAGTCATCTTTATCTCGAGATAAAGATGACTGTGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006783.4-1080s21c1
Sequence:CCGGACCTTGTTGACTGCTTTATTTCTCGAGAAATAAAGCAGTCAACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006783.4-1802s21c1
Sequence:CCGGTACACCACAAGTATCTAAATTCTCGAGAATTTAGATACTTGTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006783.4-1662s21c1
Sequence:CCGGCCAGGAATTGATACGTTTATTCTCGAGAATAAACGTATCAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008128
GJB6 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 6, 30kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-1056s1c1
Sequence:CCGGCTGCTGCTTAAATTGTGCTTTCTCGAGAAAGCACAATTTAAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-863s1c1
Sequence:CCGGCGCCTTCATGTATGTGTTCTACTCGAGTAGAACACATACATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-713s1c1
Sequence:CCGGCAGACATGAAACTGCCCGAAACTCGAGTTTCGGGCAGTTTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-1174s1c1
Sequence:CCGGGCCAGAATGCAATCACAAGTTCTCGAGAACTTGTGATTGCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008128.3-1662s1c1
Sequence:CCGGCCCAAGTATCTAAAGTTTGAACTCGAGTTCAAACTTTAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1326s21c1
Sequence:CCGGGATACTTGAGTTCGATTATTGCTCGAGCAATAATCGAACTCAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1358s21c1
Sequence:CCGGAGCTGTTCATACACAATATAACTCGAGTTATATTGTGTATGAACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1445s21c1
Sequence:CCGGCAAGTCCTATGTGAACTATATCTCGAGATATAGTTCACATAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008128
GJB6 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 6, 30kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-1056s1c1
Sequence:CCGGCTGCTGCTTAAATTGTGCTTTCTCGAGAAAGCACAATTTAAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-863s1c1
Sequence:CCGGCGCCTTCATGTATGTGTTCTACTCGAGTAGAACACATACATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-713s1c1
Sequence:CCGGCAGACATGAAACTGCCCGAAACTCGAGTTTCGGGCAGTTTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-1174s1c1
Sequence:CCGGGCCAGAATGCAATCACAAGTTCTCGAGAACTTGTGATTGCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008128.3-1662s1c1
Sequence:CCGGCCCAAGTATCTAAAGTTTGAACTCGAGTTCAAACTTTAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1326s21c1
Sequence:CCGGGATACTTGAGTTCGATTATTGCTCGAGCAATAATCGAACTCAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1358s21c1
Sequence:CCGGAGCTGTTCATACACAATATAACTCGAGTTATATTGTGTATGAACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1445s21c1
Sequence:CCGGCAAGTCCTATGTGAACTATATCTCGAGATATAGTTCACATAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008128
GJB6 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 6, 30kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-1056s1c1
Sequence:CCGGCTGCTGCTTAAATTGTGCTTTCTCGAGAAAGCACAATTTAAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-863s1c1
Sequence:CCGGCGCCTTCATGTATGTGTTCTACTCGAGTAGAACACATACATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-713s1c1
Sequence:CCGGCAGACATGAAACTGCCCGAAACTCGAGTTTCGGGCAGTTTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008128.3-1174s1c1
Sequence:CCGGGCCAGAATGCAATCACAAGTTCTCGAGAACTTGTGATTGCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008128.3-1662s1c1
Sequence:CCGGCCCAAGTATCTAAAGTTTGAACTCGAGTTCAAACTTTAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1326s21c1
Sequence:CCGGGATACTTGAGTTCGATTATTGCTCGAGCAATAATCGAACTCAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1358s21c1
Sequence:CCGGAGCTGTTCATACACAATATAACTCGAGTTATATTGTGTATGAACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008128.3-1445s21c1
Sequence:CCGGCAAGTCCTATGTGAACTATATCTCGAGATATAGTTCACATAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks