EMAIL THIS PAGE TO A FRIEND

GJB7

gap junction protein, beta 7, 25kDa

24 Gene Product Result for
Synonyms: CX25 bA136M9.1 connexin25
UniProtKB ID: Q6PEY0, B3KXL0, Q96KP0
Gene ID:
Human(375519) Summary: Connexins, such as GJB7, are involved in the formation of gap junctions, intercellular conduits that directly connect the cytoplasms of contacting cells. Each gap junction channel is formed by docking of 2 hemichannels, each of which contains 6 connexin subunits (Sohl et al., 2003 [PubMed 12881038]
cow(527611) gap junction protein, beta 7, 25kDa
domestic cat(101090437) gap junction protein, beta 7, 25kDa
dog(100687173) gap junction protein, beta 7, 25kDa
sheep(101115130) gap junction protein, beta 7, 25kDa
domestic guinea pig(100723387) gap junction protein, beta 7, 25kDa
naked mole-rat(101704629) gap junction protein, beta 7, 25kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198568 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037661 MISSION® esiRNA esiRNA human GJB7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198568 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190736 predicted 667
2 SASI_Hs01_00190737 predicted 895
3 SASI_Hs01_00190738 predicted 624
4 SASI_Hs01_00190739 predicted 357
5 SASI_Hs01_00190740 predicted 486
6 SASI_Hs01_00190741 predicted 866
7 SASI_Hs01_00190742 predicted 772
8 SASI_Hs01_00190744 predicted 505
9 SASI_Hs02_00372198 predicted 896
10 SASI_Hs01_00190745 predicted 577
11 SASI_Hs01_00190743 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198568
GJB7 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 7, 25kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-423s1c2
Sequence:CCGGCTGTCGTGTTTGTCTTCCGTTCTCGAGAACGGAAGACAAACACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-790s1c1
Sequence:CCGGCTTTAGTGTTCCCTACCTTATCTCGAGATAAGGTAGGGAACACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-789s1c1
Sequence:CCGGGCTTTAGTGTTCCCTACCTTACTCGAGTAAGGTAGGGAACACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-712s1c1
Sequence:CCGGCGCTTATCTTATCAGCCTCATCTCGAGATGAGGCTGATAAGATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198568.1-1927s1c1
Sequence:CCGGGCCCACTTGATAATTACTTAACTCGAGTTAAGTAATTATCAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198568
GJB7 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 7, 25kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-423s1c2
Sequence:CCGGCTGTCGTGTTTGTCTTCCGTTCTCGAGAACGGAAGACAAACACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-790s1c1
Sequence:CCGGCTTTAGTGTTCCCTACCTTATCTCGAGATAAGGTAGGGAACACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-789s1c1
Sequence:CCGGGCTTTAGTGTTCCCTACCTTACTCGAGTAAGGTAGGGAACACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-712s1c1
Sequence:CCGGCGCTTATCTTATCAGCCTCATCTCGAGATGAGGCTGATAAGATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198568.1-1927s1c1
Sequence:CCGGGCCCACTTGATAATTACTTAACTCGAGTTAAGTAATTATCAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198568
GJB7 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 7, 25kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-423s1c2
Sequence:CCGGCTGTCGTGTTTGTCTTCCGTTCTCGAGAACGGAAGACAAACACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-790s1c1
Sequence:CCGGCTTTAGTGTTCCCTACCTTATCTCGAGATAAGGTAGGGAACACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-789s1c1
Sequence:CCGGGCTTTAGTGTTCCCTACCTTACTCGAGTAAGGTAGGGAACACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198568.1-712s1c1
Sequence:CCGGCGCTTATCTTATCAGCCTCATCTCGAGATGAGGCTGATAAGATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198568.1-1927s1c1
Sequence:CCGGGCCCACTTGATAATTACTTAACTCGAGTTAAGTAATTATCAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks