EMAIL THIS PAGE TO A FRIEND

GJC1

gap junction protein, gamma 1, 45kDa

Synonyms: CX45 GJA7
UniProtKB ID: P36383, B3KW68, Q4VAY0
Gene ID:
Human(10052) Summary: This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]
Mouse(14615) gap junction protein, gamma 1
Rat(266706) gap junction protein, gamma 1
naked mole-rat(101710138) gap junction protein, gamma 1, 45kDa
domestic guinea pig(100720948) gap junction protein, gamma 1, 45kDa
sheep(101116241) gap junction protein, gamma 1, 45kDa
chicken(396501) gap junction protein, gamma 1, 45kDa
dog(490936) gap junction protein, gamma 1, 45kDa
domestic cat(101080495) gap junction protein, gamma 1, 45kDa
cow(511119) gap junction protein, gamma 1, 45kDa
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300213 Anti-GJA7 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1305389 ANTI-GJA7(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2100923 Anti-GJC1 antibody produced in rabbit affinity isolated antibody bovine, horse, canine, pig, human, rabbit, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005497 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080383 Rosetta Predictions human pricing
NM_005497 Rosetta Predictions human pricing
NM_001085381 Rosetta Predictions rat pricing
NM_008122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314391 predicted 553
2 SASI_Hs02_00314392 predicted 440
3 SASI_Hs02_00314393 predicted 411
4 SASI_Hs02_00314394 predicted 904
5 SASI_Hs02_00314395 predicted 379
6 SASI_Hs02_00314396 predicted 1067
7 SASI_Hs02_00314397 predicted 1508
8 SASI_Hs02_00314398 predicted 961
9 SASI_Hs02_00314399 predicted 673
10 SASI_Hs02_00314400 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339696 predicted 554
2 SASI_Hs01_00016566 predicted 444
3 SASI_Hs01_00016568 predicted 408
4 SASI_Hs01_00016569 predicted 916
5 SASI_Hs01_00016570 predicted 389
6 SASI_Hs01_00016571 predicted 1071
7 SASI_Hs01_00016572 predicted 1511
8 SASI_Hs01_00016575 predicted 970
9 SASI_Hs02_00339697 predicted 676
10 SASI_Hs02_00339698 predicted 1534
11 SASI_Hs01_00016567 predicted 387
12 SASI_Hs01_00016573 predicted 327
13 SASI_Hs01_00016574 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208989 predicted 1218
2 SASI_Rn02_00208990 predicted 1206
3 SASI_Rn02_00208991 predicted 524
4 SASI_Rn02_00208992 predicted 1047
5 SASI_Rn02_00208993 predicted 1033
6 SASI_Rn02_00208994 predicted 1274
7 SASI_Rn02_00208995 predicted 1296
8 SASI_Rn02_00208996 predicted 1167
9 SASI_Rn02_00208997 predicted 679
10 SASI_Rn02_00208998 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168925 predicted 1574
2 SASI_Mm02_00313185 predicted 1077
3 SASI_Mm01_00168926 predicted 1093
4 SASI_Mm01_00168927 predicted 1367
5 SASI_Mm01_00168928 predicted 1271
6 SASI_Mm01_00168929 predicted 1215
7 SASI_Mm01_00168930 predicted 585
8 SASI_Mm01_00168931 predicted 686
9 SASI_Mm01_00168932 predicted 1016
10 SASI_Mm01_00168933 predicted 1693
11 SASI_Mm01_00168934 predicted 1319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008122
VALIDATED
GJC1 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, gamma 1, 45kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008122.1-1025s1c1
Sequence:CCGGGCTTTCTAATAGGGCAGTATTCTCGAGAATACTGCCCTATTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-581s1c1
Sequence:CCGGCCATCTACTATGATGAACAAACTCGAGTTTGTTCATCATAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-729s1c1
Sequence:CCGGCCTGGGATATGCTATTCATAACTCGAGTTATGAATAGCATATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008122.1-1176s1c1
Sequence:CCGGCCTCTGCCTATTGCTTAACATCTCGAGATGTTAAGCAATAGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-1099s1c1
Sequence:CCGGCCTCATAAGATAGACTGCTTTCTCGAGAAAGCAGTCTATCTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1555s21c1
Sequence:CCGGCCTCTGCCTATTGCTTAACATCTCGAGATGTTAAGCAATAGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-872s21c1
Sequence:CCGGATCCACAACCATTCGACATTTCTCGAGAAATGTCGAATGGTTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1103s21c1
Sequence:CCGGATGTACCTGGGATATGCTATTCTCGAGAATAGCATATCCCAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-2271s21c1
Sequence:CCGGTCCAGAGAAGAACTGATATATCTCGAGATATATCAGTTCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1641s21c1
Sequence:CCGGTTGATGATCCGGGTGCTTATACTCGAGTATAAGCACCCGGATCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008122
VALIDATED
GJC1 MISSION shRNA shRNA Plasmid DNA
gap junction protein, gamma 1, 45kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008122.1-1025s1c1
Sequence:CCGGGCTTTCTAATAGGGCAGTATTCTCGAGAATACTGCCCTATTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-581s1c1
Sequence:CCGGCCATCTACTATGATGAACAAACTCGAGTTTGTTCATCATAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-729s1c1
Sequence:CCGGCCTGGGATATGCTATTCATAACTCGAGTTATGAATAGCATATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008122.1-1176s1c1
Sequence:CCGGCCTCTGCCTATTGCTTAACATCTCGAGATGTTAAGCAATAGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-1099s1c1
Sequence:CCGGCCTCATAAGATAGACTGCTTTCTCGAGAAAGCAGTCTATCTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1555s21c1
Sequence:CCGGCCTCTGCCTATTGCTTAACATCTCGAGATGTTAAGCAATAGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-872s21c1
Sequence:CCGGATCCACAACCATTCGACATTTCTCGAGAAATGTCGAATGGTTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1103s21c1
Sequence:CCGGATGTACCTGGGATATGCTATTCTCGAGAATAGCATATCCCAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-2271s21c1
Sequence:CCGGTCCAGAGAAGAACTGATATATCTCGAGATATATCAGTTCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1641s21c1
Sequence:CCGGTTGATGATCCGGGTGCTTATACTCGAGTATAAGCACCCGGATCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008122
VALIDATED
GJC1 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, gamma 1, 45kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008122.1-1025s1c1
Sequence:CCGGGCTTTCTAATAGGGCAGTATTCTCGAGAATACTGCCCTATTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-581s1c1
Sequence:CCGGCCATCTACTATGATGAACAAACTCGAGTTTGTTCATCATAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-729s1c1
Sequence:CCGGCCTGGGATATGCTATTCATAACTCGAGTTATGAATAGCATATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008122.1-1176s1c1
Sequence:CCGGCCTCTGCCTATTGCTTAACATCTCGAGATGTTAAGCAATAGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008122.1-1099s1c1
Sequence:CCGGCCTCATAAGATAGACTGCTTTCTCGAGAAAGCAGTCTATCTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1555s21c1
Sequence:CCGGCCTCTGCCTATTGCTTAACATCTCGAGATGTTAAGCAATAGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-872s21c1
Sequence:CCGGATCCACAACCATTCGACATTTCTCGAGAAATGTCGAATGGTTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1103s21c1
Sequence:CCGGATGTACCTGGGATATGCTATTCTCGAGAATAGCATATCCCAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-2271s21c1
Sequence:CCGGTCCAGAGAAGAACTGATATATCTCGAGATATATCAGTTCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008122.3-1641s21c1
Sequence:CCGGTTGATGATCCGGGTGCTTATACTCGAGTATAAGCACCCGGATCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005497
VALIDATED
GJC1 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, gamma 1, 45kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-775s1c1
Sequence:CCGGCGAGACTCACTAAACAGTAAACTCGAGTTTACTGTTTAGTGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-283s1c1
Sequence:CCGGGCTATCCACAAGATTGCCAAACTCGAGTTTGGCAATCTTGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-815s1c1
Sequence:CCGGCGGGTGCTTATAATTATCCTTCTCGAGAAGGATAATTATAAGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005497.1-125s1c1
Sequence:CCGGCCATCTATTACGATGAGCAAACTCGAGTTTGCTCATCGTAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-629s1c1
Sequence:CCGGGCAGACTTCCTTGTCCTCATACTCGAGTATGAGGACAAGGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005497.3-620s21c1
Sequence:CCGGCCCTATGCAATGCGCTGGAAACTCGAGTTTCCAGCGCATTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005497.3-1819s21c1
Sequence:CCGGCATTGAACTGCTGTAGTTATACTCGAGTATAACTACAGCAGTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005497.3-1446s21c1
Sequence:CCGGAGACCTCCGTCTGGATTTAATCTCGAGATTAAATCCAGACGGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005497
VALIDATED
GJC1 MISSION shRNA shRNA Plasmid DNA
gap junction protein, gamma 1, 45kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-775s1c1
Sequence:CCGGCGAGACTCACTAAACAGTAAACTCGAGTTTACTGTTTAGTGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-283s1c1
Sequence:CCGGGCTATCCACAAGATTGCCAAACTCGAGTTTGGCAATCTTGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-815s1c1
Sequence:CCGGCGGGTGCTTATAATTATCCTTCTCGAGAAGGATAATTATAAGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005497.1-125s1c1
Sequence:CCGGCCATCTATTACGATGAGCAAACTCGAGTTTGCTCATCGTAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-629s1c1
Sequence:CCGGGCAGACTTCCTTGTCCTCATACTCGAGTATGAGGACAAGGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005497.3-620s21c1
Sequence:CCGGCCCTATGCAATGCGCTGGAAACTCGAGTTTCCAGCGCATTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005497.3-1819s21c1
Sequence:CCGGCATTGAACTGCTGTAGTTATACTCGAGTATAACTACAGCAGTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005497.3-1446s21c1
Sequence:CCGGAGACCTCCGTCTGGATTTAATCTCGAGATTAAATCCAGACGGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005497
VALIDATED
GJC1 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, gamma 1, 45kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-775s1c1
Sequence:CCGGCGAGACTCACTAAACAGTAAACTCGAGTTTACTGTTTAGTGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-283s1c1
Sequence:CCGGGCTATCCACAAGATTGCCAAACTCGAGTTTGGCAATCTTGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-815s1c1
Sequence:CCGGCGGGTGCTTATAATTATCCTTCTCGAGAAGGATAATTATAAGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005497.1-125s1c1
Sequence:CCGGCCATCTATTACGATGAGCAAACTCGAGTTTGCTCATCGTAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005497.1-629s1c1
Sequence:CCGGGCAGACTTCCTTGTCCTCATACTCGAGTATGAGGACAAGGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005497.3-620s21c1
Sequence:CCGGCCCTATGCAATGCGCTGGAAACTCGAGTTTCCAGCGCATTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005497.3-1819s21c1
Sequence:CCGGCATTGAACTGCTGTAGTTATACTCGAGTATAACTACAGCAGTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005497.3-1446s21c1
Sequence:CCGGAGACCTCCGTCTGGATTTAATCTCGAGATTAAATCCAGACGGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks