EMAIL THIS PAGE TO A FRIEND

GJC2

gap junction protein, gamma 2, 47kDa

73 Gene Product Result for
Synonyms: CX46.6 Cx47 GJA12 HLD2 LMPH1C PMLDAR SPG44
UniProtKB ID: Q5T442, O43440, Q7Z7J2, Q8IWJ9
Gene ID:
Human(57165) Summary: This gene encodes a gap junction protein. Gap junction proteins are members of a large family of homologous connexins and comprise 4 transmembrane, 2 extracellular, and 3 cytoplasmic domains. This gene plays a key role in central myelination and is involved in peripheral myelination in humans. Defects in this gene are the cause of autosomal recessive Pelizaeus-Merzbacher-like disease-1. [provided by RefSeq, Jul 2008]
Mouse(118454) gap junction protein, gamma 2
Rat(497913) gap junction protein, gamma 2
chicken(420397) gap junction protein, gamma 12, 47kDa
cow(538745) gap junction protein, gamma 2, 47kDa
domestic cat(101099269) gap junction protein, gamma 2, 47kDa
dog(607294) gap junction protein, gamma 2, 47kDa
sheep(101122355) gap junction protein, gamma 2, 47kDa
domestic guinea pig(100716765) gap junction protein, gamma 2, 47kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020435 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020435 Rosetta Predictions human pricing
XM_001076914 Rosetta Predictions rat pricing
XM_573100 Rosetta Predictions rat pricing
NM_080454 Rosetta Predictions mouse pricing
NM_175452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150845 predicted 1854
2 SASI_Hs01_00150846 predicted 228
3 SASI_Hs01_00150847 predicted 1477
4 SASI_Hs01_00150848 predicted 1903
5 SASI_Hs01_00150849 predicted 1710
6 SASI_Hs01_00150850 predicted 1772
7 SASI_Hs01_00150851 predicted 1855
8 SASI_Hs01_00150852 predicted 233
9 SASI_Hs01_00150853 predicted 1488
10 SASI_Hs01_00150854 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355019 predicted 1065
2 SASI_Rn02_00355020 predicted 904
3 SASI_Rn02_00355021 predicted 1033
4 SASI_Rn02_00355022 predicted 327
5 SASI_Rn02_00355023 predicted 202
6 SASI_Rn02_00355024 predicted 818
7 SASI_Rn02_00355025 predicted 870
8 SASI_Rn02_00355026 predicted 854
9 SASI_Rn02_00355027 predicted 310
10 SASI_Rn02_00355028 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399778 predicted 775
2 SASI_Rn02_00399779 predicted 319
3 SASI_Rn02_00399780 predicted 322
4 SASI_Rn02_00399781 predicted 197
5 SASI_Rn02_00399782 predicted 310
6 SASI_Rn02_00399783 predicted 1833
7 SASI_Rn02_00399784 predicted 583
8 SASI_Rn02_00399785 predicted 685
9 SASI_Rn02_00399786 predicted 220
10 SASI_Rn02_00399787 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121852 predicted 1391
2 SASI_Mm01_00121853 predicted 1806
3 SASI_Mm01_00121854 predicted 1174
4 SASI_Mm01_00121855 predicted 1517
5 SASI_Mm01_00121856 predicted 1615
6 SASI_Mm01_00121857 predicted 1464
7 SASI_Mm01_00121858 predicted 325
8 SASI_Mm01_00121859 predicted 1810
9 SASI_Mm01_00121860 predicted 1461
10 SASI_Mm01_00121861 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084795 predicted 1409
2 SASI_Mm02_00346354 predicted 643
3 SASI_Mm02_00346355 predicted 223
4 SASI_Mm02_00346356 predicted 872
5 SASI_Mm01_00084797 predicted 1187
6 SASI_Mm01_00084798 predicted 1540
7 SASI_Mm01_00084799 predicted 1625
8 SASI_Mm01_00084800 predicted 1474
9 SASI_Mm01_00084801 predicted 343
10 SASI_Mm01_00084803 predicted 1485
11 SASI_Mm01_00084796 predicted 1830
12 SASI_Mm01_00084802 predicted 1827
13 SASI_Mm01_00084804 predicted 1456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020435
GJC2 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, gamma 2, 47kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-1211s21c1
Sequence:CCGGCATGACCAGAACCTGGCAAACCTCGAGGTTTGCCAGGTTCTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-884s21c1
Sequence:CCGGTTCGAGGTGCGACCGTTCTTTCTCGAGAAAGAACGGTCGCACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020435.2-1996s21c1
Sequence:CCGGGACAGGACCATACCCTCTTTGCTCGAGCAAAGAGGGTATGGTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-321s21c1
Sequence:CCGGACGAGCAGGCCAAGTTCACTTCTCGAGAAGTGAACTTGGCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-968s21c1
Sequence:CCGGACGGTCTTCCTGCTGGTTATGCTCGAGCATAACCAGCAGGAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020435
GJC2 MISSION shRNA shRNA Plasmid DNA
gap junction protein, gamma 2, 47kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-1211s21c1
Sequence:CCGGCATGACCAGAACCTGGCAAACCTCGAGGTTTGCCAGGTTCTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-884s21c1
Sequence:CCGGTTCGAGGTGCGACCGTTCTTTCTCGAGAAAGAACGGTCGCACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020435.2-1996s21c1
Sequence:CCGGGACAGGACCATACCCTCTTTGCTCGAGCAAAGAGGGTATGGTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-321s21c1
Sequence:CCGGACGAGCAGGCCAAGTTCACTTCTCGAGAAGTGAACTTGGCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-968s21c1
Sequence:CCGGACGGTCTTCCTGCTGGTTATGCTCGAGCATAACCAGCAGGAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020435
GJC2 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, gamma 2, 47kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-1211s21c1
Sequence:CCGGCATGACCAGAACCTGGCAAACCTCGAGGTTTGCCAGGTTCTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-884s21c1
Sequence:CCGGTTCGAGGTGCGACCGTTCTTTCTCGAGAAAGAACGGTCGCACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020435.2-1996s21c1
Sequence:CCGGGACAGGACCATACCCTCTTTGCTCGAGCAAAGAGGGTATGGTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-321s21c1
Sequence:CCGGACGAGCAGGCCAAGTTCACTTCTCGAGAAGTGAACTTGGCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020435.2-968s21c1
Sequence:CCGGACGGTCTTCCTGCTGGTTATGCTCGAGCATAACCAGCAGGAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080454
GJC2 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, gamma 2, 47kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-217s1c1
Sequence:CCGGCCATCTATTCAGATGAGCAATCTCGAGATTGCTCATCTGAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-233s1c1
Sequence:CCGGGCAATCCAAGTTCACCTGCAACTCGAGTTGCAGGTGAACTTGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-896s1c1
Sequence:CCGGCGTGGTTAGCTGTCTATGCTTCTCGAGAAGCATAGACAGCTAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-354s1c1
Sequence:CCGGTCTGTCATGTACCTGGGCTATCTCGAGATAGCCCAGGTACATGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-1319s1c1
Sequence:CCGGTCAGGAACAACTGGCCACTAACTCGAGTTAGTGGCCAGTTGTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080454
GJC2 MISSION shRNA shRNA Plasmid DNA
gap junction protein, gamma 2, 47kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-217s1c1
Sequence:CCGGCCATCTATTCAGATGAGCAATCTCGAGATTGCTCATCTGAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-233s1c1
Sequence:CCGGGCAATCCAAGTTCACCTGCAACTCGAGTTGCAGGTGAACTTGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-896s1c1
Sequence:CCGGCGTGGTTAGCTGTCTATGCTTCTCGAGAAGCATAGACAGCTAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-354s1c1
Sequence:CCGGTCTGTCATGTACCTGGGCTATCTCGAGATAGCCCAGGTACATGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-1319s1c1
Sequence:CCGGTCAGGAACAACTGGCCACTAACTCGAGTTAGTGGCCAGTTGTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080454
GJC2 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, gamma 2, 47kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-217s1c1
Sequence:CCGGCCATCTATTCAGATGAGCAATCTCGAGATTGCTCATCTGAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-233s1c1
Sequence:CCGGGCAATCCAAGTTCACCTGCAACTCGAGTTGCAGGTGAACTTGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-896s1c1
Sequence:CCGGCGTGGTTAGCTGTCTATGCTTCTCGAGAAGCATAGACAGCTAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-354s1c1
Sequence:CCGGTCTGTCATGTACCTGGGCTATCTCGAGATAGCCCAGGTACATGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080454.2-1319s1c1
Sequence:CCGGTCAGGAACAACTGGCCACTAACTCGAGTTAGTGGCCAGTTGTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks