EMAIL THIS PAGE TO A FRIEND

GJC3

gap junction protein, gamma 3, 30.2kDa

61 Gene Product Result for
Synonyms: CX29 CX30.2 CX31.3 GJE1
UniProtKB ID: Q8NFK1, A4D296, Q86XI9
Gene ID:
Human(349149) Summary: This gene encodes a gap junction protein. The encoded protein, also known as a connexin, plays a role in formation of gap junctions, which provide direct connections between neighboring cells. Mutations in this gene have been reported to be associated with nonsyndromic hearing loss.[provided by RefSeq, Feb 2010]
Mouse(118446) gap junction protein, gamma 3
Rat(288529) gap junction protein, gamma 3
domestic guinea pig(100721800) gap junction protein, gamma 3, 30.2kDa
naked mole-rat(101721195) gap junction protein, gamma 3, 30.2kDa
cow(539991) gap junction protein, gamma 3, 30.2kDa
domestic cat(101097444) gap junction protein, gamma 3, 30.2kDa
dog(489850) gap junction protein, gamma 3, 30.2kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181538 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181538 Rosetta Predictions human pricing
XM_001075553 Rosetta Predictions rat pricing
XM_221997 Rosetta Predictions rat pricing
NM_080450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046118 predicted 493
2 SASI_Hs01_00046119 predicted 516
3 SASI_Hs01_00046121 predicted 503
4 SASI_Hs01_00046124 predicted 492
5 SASI_Hs01_00046125 predicted 255
6 SASI_Hs01_00046126 predicted 510
7 SASI_Hs01_00046127 predicted 289
8 SASI_Hs02_00370163 predicted 500
9 SASI_Hs02_00370164 predicted 263
10 SASI_Hs02_00370165 predicted 259
11 SASI_Hs01_00046120 predicted 487
12 SASI_Hs01_00046122 predicted 476
13 SASI_Hs01_00046123 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350208 predicted 482
2 SASI_Rn02_00350209 predicted 691
3 SASI_Rn02_00350210 predicted 317
4 SASI_Rn02_00350211 predicted 407
5 SASI_Rn02_00350212 predicted 495
6 SASI_Rn02_00350213 predicted 364
7 SASI_Rn02_00350214 predicted 503
8 SASI_Rn02_00350215 predicted 617
9 SASI_Rn02_00350216 predicted 374
10 SASI_Rn02_00350217 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380499 predicted 514
2 SASI_Rn02_00380500 predicted 775
3 SASI_Rn02_00380501 predicted 511
4 SASI_Rn02_00380502 predicted 315
5 SASI_Rn02_00380503 predicted 488
6 SASI_Rn02_00380504 predicted 610
7 SASI_Rn02_00380505 predicted 667
8 SASI_Rn02_00380506 predicted 364
9 SASI_Rn02_00380507 predicted 373
10 SASI_Rn02_00380508 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151579 predicted 546
2 SASI_Mm01_00151581 predicted 262
3 SASI_Mm01_00151582 predicted 537
4 SASI_Mm01_00151583 predicted 238
5 SASI_Mm01_00151584 predicted 526
6 SASI_Mm01_00151585 predicted 367
7 SASI_Mm01_00151587 predicted 820
8 SASI_Mm01_00151588 predicted 357
9 SASI_Mm02_00338106 predicted 427
10 SASI_Mm02_00338107 predicted 269
11 SASI_Mm01_00151580 predicted 382
12 SASI_Mm01_00151586 predicted 1379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181538
GJC3 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, gamma 3, 30.2kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-596s1c1
Sequence:CCGGGCGGTTTCTGTCTCTTGTTTACTCGAGTAAACAAGAGACAGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-512s1c1
Sequence:CCGGGAGAACCTTGCCTTGGTAGTACTCGAGTACTACCAAGGCAAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-523s1c1
Sequence:CCGGCTTGGTAGTATAACCTGCAATCTCGAGATTGCAGGTTATACTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-680s1c1
Sequence:CCGGCCTCTTCTAAATACTTCCTAACTCGAGTTAGGAAGTATTTAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-303s1c1
Sequence:CCGGGCACTGGGAATTATCAGGAAACTCGAGTTTCCTGATAATTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-464s21c1
Sequence:CCGGAGTACCACCTGTATGGGTTCCCTCGAGGGAACCCATACAGGTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-722s21c1
Sequence:CCGGACAAGAAAGCAACCGATAGCCCTCGAGGGCTATCGGTTGCTTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-624s21c1
Sequence:CCGGGGAGCTTGTGCTTCTGGGTTTCTCGAGAAACCCAGAAGCACAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181538
GJC3 MISSION shRNA shRNA Plasmid DNA
gap junction protein, gamma 3, 30.2kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-596s1c1
Sequence:CCGGGCGGTTTCTGTCTCTTGTTTACTCGAGTAAACAAGAGACAGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-512s1c1
Sequence:CCGGGAGAACCTTGCCTTGGTAGTACTCGAGTACTACCAAGGCAAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-523s1c1
Sequence:CCGGCTTGGTAGTATAACCTGCAATCTCGAGATTGCAGGTTATACTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-680s1c1
Sequence:CCGGCCTCTTCTAAATACTTCCTAACTCGAGTTAGGAAGTATTTAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-303s1c1
Sequence:CCGGGCACTGGGAATTATCAGGAAACTCGAGTTTCCTGATAATTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-464s21c1
Sequence:CCGGAGTACCACCTGTATGGGTTCCCTCGAGGGAACCCATACAGGTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-722s21c1
Sequence:CCGGACAAGAAAGCAACCGATAGCCCTCGAGGGCTATCGGTTGCTTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-624s21c1
Sequence:CCGGGGAGCTTGTGCTTCTGGGTTTCTCGAGAAACCCAGAAGCACAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181538
GJC3 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, gamma 3, 30.2kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-596s1c1
Sequence:CCGGGCGGTTTCTGTCTCTTGTTTACTCGAGTAAACAAGAGACAGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-512s1c1
Sequence:CCGGGAGAACCTTGCCTTGGTAGTACTCGAGTACTACCAAGGCAAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-523s1c1
Sequence:CCGGCTTGGTAGTATAACCTGCAATCTCGAGATTGCAGGTTATACTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-680s1c1
Sequence:CCGGCCTCTTCTAAATACTTCCTAACTCGAGTTAGGAAGTATTTAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181538.1-303s1c1
Sequence:CCGGGCACTGGGAATTATCAGGAAACTCGAGTTTCCTGATAATTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-464s21c1
Sequence:CCGGAGTACCACCTGTATGGGTTCCCTCGAGGGAACCCATACAGGTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-722s21c1
Sequence:CCGGACAAGAAAGCAACCGATAGCCCTCGAGGGCTATCGGTTGCTTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181538.2-624s21c1
Sequence:CCGGGGAGCTTGTGCTTCTGGGTTTCTCGAGAAACCCAGAAGCACAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080450
GJC3 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, gamma 3, 30.2kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-672s1c1
Sequence:CCGGCCTCAACATCATGTTTGGGATCTCGAGATCCCAAACATGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-228s1c1
Sequence:CCGGCGGCAATGATGAGAATGAATTCTCGAGAATTCATTCTCATCATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-821s1c1
Sequence:CCGGCCAAGGACACAACCGATGAATCTCGAGATTCATCGGTTGTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-356s1c1
Sequence:CCGGCCAGTGCCATTTATGTGGCTTCTCGAGAAGCCACATAAATGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-768s1c1
Sequence:CCGGGCACAAACTTTCCTTCTTAAACTCGAGTTTAAGAAGGAAAGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080450
GJC3 MISSION shRNA shRNA Plasmid DNA
gap junction protein, gamma 3, 30.2kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-672s1c1
Sequence:CCGGCCTCAACATCATGTTTGGGATCTCGAGATCCCAAACATGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-228s1c1
Sequence:CCGGCGGCAATGATGAGAATGAATTCTCGAGAATTCATTCTCATCATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-821s1c1
Sequence:CCGGCCAAGGACACAACCGATGAATCTCGAGATTCATCGGTTGTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-356s1c1
Sequence:CCGGCCAGTGCCATTTATGTGGCTTCTCGAGAAGCCACATAAATGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-768s1c1
Sequence:CCGGGCACAAACTTTCCTTCTTAAACTCGAGTTTAAGAAGGAAAGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080450
GJC3 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, gamma 3, 30.2kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-672s1c1
Sequence:CCGGCCTCAACATCATGTTTGGGATCTCGAGATCCCAAACATGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-228s1c1
Sequence:CCGGCGGCAATGATGAGAATGAATTCTCGAGAATTCATTCTCATCATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-821s1c1
Sequence:CCGGCCAAGGACACAACCGATGAATCTCGAGATTCATCGGTTGTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-356s1c1
Sequence:CCGGCCAGTGCCATTTATGTGGCTTCTCGAGAAGCCACATAAATGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080450.2-768s1c1
Sequence:CCGGGCACAAACTTTCCTTCTTAAACTCGAGTTTAAGAAGGAAAGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks