EMAIL THIS PAGE TO A FRIEND

GJD2

gap junction protein, delta 2, 36kDa

48 Gene Product Result for
Synonyms: CX36 GJA9
UniProtKB ID: Q9UKL4, Q2M241, Q9P2R0
Gene ID:
Human(57369) Summary: This gene encodes a member of the connexin protein family. Connexins are gap junction proteins which are arranged in groups of 6 around a central pore to form a connexon, a component of the gap junction intercellular channel. The channels formed by this protein allow cationic molecule exchange between human beta cells and may function in the regulation of insulin secretion. [provided by RefSeq, Oct 2012]
Mouse(14617) gap junction protein, delta 2
Rat(50564) gap junction protein, delta 2
chicken(395273) gap junction protein, delta 2, 36kDa
domestic cat(101095985) gap junction protein, delta 2, 36kDa
cow(282577) gap junction protein, delta 2, 36kDa
dog(487477) gap junction protein, delta 2, 36kDa
sheep(101103323) gap junction protein, delta 2, 36kDa
Domestic Rabbit(100343220) gap junction protein, delta 2, 36kDa
domestic guinea pig(100731673) gap junction protein, delta 2, 36kDa
naked mole-rat(101723189) gap junction protein, delta 2, 36kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020660 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020660 Rosetta Predictions human pricing
NM_019281 Rosetta Predictions rat pricing
NM_010290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163796 predicted 631
2 SASI_Hs02_00353643 predicted 573
3 SASI_Hs01_00163798 predicted 310
4 SASI_Hs01_00163799 predicted 494
5 SASI_Hs02_00353644 predicted 606
6 SASI_Hs01_00163800 predicted 532
7 SASI_Hs01_00163801 predicted 411
8 SASI_Hs01_00163802 predicted 527
9 SASI_Hs01_00163803 predicted 234
10 SASI_Hs01_00163805 predicted 582
11 SASI_Hs01_00163797 predicted 232
12 SASI_Hs01_00163804 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090543 predicted 898
2 SASI_Rn01_00090544 predicted 910
3 SASI_Rn01_00090545 predicted 198
4 SASI_Rn01_00090546 predicted 336
5 SASI_Rn01_00090547 predicted 843
6 SASI_Rn01_00090548 predicted 532
7 SASI_Rn01_00090549 predicted 295
8 SASI_Rn01_00090550 predicted 702
9 SASI_Rn01_00090551 predicted 525
10 SASI_Rn02_00262209 predicted 867
11 SASI_Rn01_00090552 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129155 predicted 1274
2 SASI_Mm01_00129156 predicted 761
3 SASI_Mm02_00318260 predicted 569
4 SASI_Mm01_00129157 predicted 1214
5 SASI_Mm01_00129158 predicted 705
6 SASI_Mm01_00129159 predicted 1353
7 SASI_Mm01_00129161 predicted 899
8 SASI_Mm01_00129162 predicted 903
9 SASI_Mm01_00129163 predicted 978
10 SASI_Mm01_00129164 predicted 665
11 SASI_Mm01_00129160 predicted 1236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010290
GJD2 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, delta 2, 36kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1780s21c1
Sequence:CCGGGGTGAATGGCATGAGTCAAACCTCGAGGTTTGACTCATGCCATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010290.2-577s21c1
Sequence:CCGGTGATCTTCCGGATACTCATTGCTCGAGCAATGAGTATCCGGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1826s21c1
Sequence:CCGGCATCTCAGCACATACCCTTATCTCGAGATAAGGGTATGTGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010290.2-1086s21c1
Sequence:CCGGATCCAAGTGGTGTTTCGAAATCTCGAGATTTCGAAACACCACTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1556s21c1
Sequence:CCGGGGTCTAGGATACAGATATTAACTCGAGTTAATATCTGTATCCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-707s1c1
Sequence:CCGGCCATATACGTTACTGGGTCTTCTCGAGAAGACCCAGTAACGTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-632s1c1
Sequence:CCGGGCAGACCATGTTTGTGTGCAACTCGAGTTGCACACAAACATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010290.2-2472s1c1
Sequence:CCGGCCCGTGTCAATCCCAACTTATCTCGAGATAAGTTGGGATTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-1224s1c1
Sequence:CCGGCCTACCGAGAAGACAGTCTTTCTCGAGAAAGACTGTCTTCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-1350s1c1
Sequence:CCGGGCCAAGAGGAAGTCAGTCTATCTCGAGATAGACTGACTTCCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010290
GJD2 MISSION shRNA shRNA Plasmid DNA
gap junction protein, delta 2, 36kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1780s21c1
Sequence:CCGGGGTGAATGGCATGAGTCAAACCTCGAGGTTTGACTCATGCCATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010290.2-577s21c1
Sequence:CCGGTGATCTTCCGGATACTCATTGCTCGAGCAATGAGTATCCGGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1826s21c1
Sequence:CCGGCATCTCAGCACATACCCTTATCTCGAGATAAGGGTATGTGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010290.2-1086s21c1
Sequence:CCGGATCCAAGTGGTGTTTCGAAATCTCGAGATTTCGAAACACCACTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1556s21c1
Sequence:CCGGGGTCTAGGATACAGATATTAACTCGAGTTAATATCTGTATCCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-707s1c1
Sequence:CCGGCCATATACGTTACTGGGTCTTCTCGAGAAGACCCAGTAACGTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-632s1c1
Sequence:CCGGGCAGACCATGTTTGTGTGCAACTCGAGTTGCACACAAACATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010290.2-2472s1c1
Sequence:CCGGCCCGTGTCAATCCCAACTTATCTCGAGATAAGTTGGGATTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-1224s1c1
Sequence:CCGGCCTACCGAGAAGACAGTCTTTCTCGAGAAAGACTGTCTTCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-1350s1c1
Sequence:CCGGGCCAAGAGGAAGTCAGTCTATCTCGAGATAGACTGACTTCCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010290
GJD2 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, delta 2, 36kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1780s21c1
Sequence:CCGGGGTGAATGGCATGAGTCAAACCTCGAGGTTTGACTCATGCCATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010290.2-577s21c1
Sequence:CCGGTGATCTTCCGGATACTCATTGCTCGAGCAATGAGTATCCGGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1826s21c1
Sequence:CCGGCATCTCAGCACATACCCTTATCTCGAGATAAGGGTATGTGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010290.2-1086s21c1
Sequence:CCGGATCCAAGTGGTGTTTCGAAATCTCGAGATTTCGAAACACCACTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010290.2-1556s21c1
Sequence:CCGGGGTCTAGGATACAGATATTAACTCGAGTTAATATCTGTATCCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-707s1c1
Sequence:CCGGCCATATACGTTACTGGGTCTTCTCGAGAAGACCCAGTAACGTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-632s1c1
Sequence:CCGGGCAGACCATGTTTGTGTGCAACTCGAGTTGCACACAAACATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010290.2-2472s1c1
Sequence:CCGGCCCGTGTCAATCCCAACTTATCTCGAGATAAGTTGGGATTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-1224s1c1
Sequence:CCGGCCTACCGAGAAGACAGTCTTTCTCGAGAAAGACTGTCTTCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010290.2-1350s1c1
Sequence:CCGGGCCAAGAGGAAGTCAGTCTATCTCGAGATAGACTGACTTCCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020660
GJD2 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, delta 2, 36kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-583s21c1
Sequence:CCGGATCTCCCGCTTCTACATTATCCTCGAGGATAATGTAGAAGCGGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-140s21c1
Sequence:CCGGATGATGAGCAGACCATGTTTGCTCGAGCAAACATGGTCTGCTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-877s21c1
Sequence:CCGGTCAATCTATGAGATTCGTAACCTCGAGGTTACGAATCTCATAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-495s1c1
Sequence:CCGGGCCAGATTGTTTAGAGGTTAACTCGAGTTAACCTCTAAACAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-493s1c1
Sequence:CCGGGAGCCAGATTGTTTAGAGGTTCTCGAGAACCTCTAAACAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-322s1c1
Sequence:CCGGCGCTACTCTACAGTCTTCCTACTCGAGTAGGAAGACTGTAGAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-675s1c1
Sequence:CCGGCCCAGGGTTGTATGAGTGTAACTCGAGTTACACTCATACAACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020660
GJD2 MISSION shRNA shRNA Plasmid DNA
gap junction protein, delta 2, 36kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-583s21c1
Sequence:CCGGATCTCCCGCTTCTACATTATCCTCGAGGATAATGTAGAAGCGGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-140s21c1
Sequence:CCGGATGATGAGCAGACCATGTTTGCTCGAGCAAACATGGTCTGCTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-877s21c1
Sequence:CCGGTCAATCTATGAGATTCGTAACCTCGAGGTTACGAATCTCATAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-495s1c1
Sequence:CCGGGCCAGATTGTTTAGAGGTTAACTCGAGTTAACCTCTAAACAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-493s1c1
Sequence:CCGGGAGCCAGATTGTTTAGAGGTTCTCGAGAACCTCTAAACAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-322s1c1
Sequence:CCGGCGCTACTCTACAGTCTTCCTACTCGAGTAGGAAGACTGTAGAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-675s1c1
Sequence:CCGGCCCAGGGTTGTATGAGTGTAACTCGAGTTACACTCATACAACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020660
GJD2 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, delta 2, 36kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-583s21c1
Sequence:CCGGATCTCCCGCTTCTACATTATCCTCGAGGATAATGTAGAAGCGGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-140s21c1
Sequence:CCGGATGATGAGCAGACCATGTTTGCTCGAGCAAACATGGTCTGCTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020660.1-877s21c1
Sequence:CCGGTCAATCTATGAGATTCGTAACCTCGAGGTTACGAATCTCATAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-495s1c1
Sequence:CCGGGCCAGATTGTTTAGAGGTTAACTCGAGTTAACCTCTAAACAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-493s1c1
Sequence:CCGGGAGCCAGATTGTTTAGAGGTTCTCGAGAACCTCTAAACAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-322s1c1
Sequence:CCGGCGCTACTCTACAGTCTTCCTACTCGAGTAGGAAGACTGTAGAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020660.1-675s1c1
Sequence:CCGGCCCAGGGTTGTATGAGTGTAACTCGAGTTACACTCATACAACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks