EMAIL THIS PAGE TO A FRIEND

GJD3

gap junction protein, delta 3, 31.9kDa

57 Gene Product Result for
Synonyms: CX31.9 Cx30.2 GJA11 GJC1
UniProtKB ID: Q8N144, Q6ZUW6
Gene ID:
Human(125111) Summary: This gene is a member of the large family of connexins that are required for the formation of gap junctions. Six connexin monomers form a hemichannel, or connexon, on the cell surface. This connexon can interact with a connexon from a neighboring cell, thus forming a channel linking the cytoplasm of the 2 cells. [provided by RefSeq, Jul 2008]
Mouse(353155) gap junction protein, delta 3
Rat(363677) gap junction protein, delta 3
domestic guinea pig(100729895) gap junction protein, delta 3, 31.9kDa
naked mole-rat(101722617) gap junction protein, delta 3, 31.9kDa
sheep(101108501) gap junction protein, delta 3, 31.9kDa
Domestic Rabbit(100009380) gap junction protein, delta 3, 31.9kDa
chicken(424196) gap junction protein, delta 3, 31.9kDa
dog(100685801) gap junction protein, delta 3, 31.9kDa
cow(616824) gap junction protein, delta 3, 31.9kDa
Horse(100050732) gap junction protein, delta 3, 31.9kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36631 Anti-GJC1 antibody produced in rabbit IgG fraction of antiserum horse, mouse, rat, rabbit, bovine, canine, human
western blot pricing
SAB2106393 Anti-GJD3 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152219 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152219 Rosetta Predictions human pricing
XM_001081399 Rosetta Predictions rat pricing
XM_343965 Rosetta Predictions rat pricing
NM_178596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365700 predicted 2178
2 SASI_Hs01_00159386 predicted 1005
3 SASI_Hs02_00365701 predicted 2184
4 SASI_Hs02_00365702 predicted 2197
5 SASI_Hs02_00365703 predicted 2214
6 SASI_Hs02_00365704 predicted 2259
7 SASI_Hs02_00365705 predicted 2133
8 SASI_Hs02_00365706 predicted 1432
9 SASI_Hs02_00365707 predicted 1554
10 SASI_Hs02_00365708 predicted 1094
11 SASI_Hs01_00159383 predicted 955
12 SASI_Hs01_00159384 predicted 939
13 SASI_Hs01_00159385 predicted 943
14 SASI_Hs01_00159387 predicted 963
15 SASI_Hs01_00159388 predicted 1480
16 SASI_Hs01_00159389 predicted 1004
17 SASI_Hs01_00159390 predicted 931
18 SASI_Hs01_00159391 predicted 989
19 SASI_Hs01_00159392 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371730 predicted 563
2 SASI_Rn02_00371731 predicted 214
3 SASI_Rn02_00371732 predicted 144
4 SASI_Rn02_00371733 predicted 560
5 SASI_Rn02_00371734 predicted 262
6 SASI_Rn02_00371735 predicted 560
7 SASI_Rn02_00371736 predicted 71
8 SASI_Rn02_00371737 predicted 551
9 SASI_Rn02_00371738 predicted 728
10 SASI_Rn02_00371739 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396605 predicted 564
2 SASI_Rn02_00396606 predicted 175
3 SASI_Rn02_00396607 predicted 214
4 SASI_Rn02_00396608 predicted 142
5 SASI_Rn02_00396609 predicted 553
6 SASI_Rn02_00396610 predicted 183
7 SASI_Rn02_00396611 predicted 261
8 SASI_Rn02_00396612 predicted 170
9 SASI_Rn02_00396613 predicted 560
10 SASI_Rn02_00396614 predicted 173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144806 predicted 254
2 SASI_Mm01_00144807 predicted 560
3 SASI_Mm01_00144808 predicted 473
4 SASI_Mm01_00144809 predicted 514
5 SASI_Mm01_00144810 predicted 498
6 SASI_Mm01_00144811 predicted 215
7 SASI_Mm01_00144812 predicted 531
8 SASI_Mm01_00144813 predicted 397
9 SASI_Mm01_00144814 predicted 503
10 SASI_Mm01_00144815 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152219
GJD3 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, delta 3, 31.9kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152219.2-1834s1c1
Sequence:CCGGCCCGAACACTATCCATGCTATCTCGAGATAGCATGGATAGTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1441s1c1
Sequence:CCGGCCGTCTTCGTGCTCTTCTATTCTCGAGAATAGAAGAGCACGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1142s1c1
Sequence:CCGGCCCGGTGCTGTTCGTCGTCTACTCGAGTAGACGACGAACAGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1702s1c1
Sequence:CCGGGCTTCCGTAGGGAAAGCACTTCTCGAGAAGTGCTTTCCCTACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1606s1c1
Sequence:CCGGCGCCACCTATTGTTGTCACTTCTCGAGAAGTGACAACAATAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152219.3-1557s21c1
Sequence:CCGGTGCAACCGTGCACACGAAGAGCTCGAGCTCTTCGTGTGCACGGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152219.3-2192s21c1
Sequence:CCGGGTGCATACACGGACACATAAGCTCGAGCTTATGTGTCCGTGTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152219.3-2080s21c1
Sequence:CCGGGAAGGTGGAGAGTGGTTGTTTCTCGAGAAACAACCACTCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152219
GJD3 MISSION shRNA shRNA Plasmid DNA
gap junction protein, delta 3, 31.9kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152219.2-1834s1c1
Sequence:CCGGCCCGAACACTATCCATGCTATCTCGAGATAGCATGGATAGTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1441s1c1
Sequence:CCGGCCGTCTTCGTGCTCTTCTATTCTCGAGAATAGAAGAGCACGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1142s1c1
Sequence:CCGGCCCGGTGCTGTTCGTCGTCTACTCGAGTAGACGACGAACAGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1702s1c1
Sequence:CCGGGCTTCCGTAGGGAAAGCACTTCTCGAGAAGTGCTTTCCCTACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1606s1c1
Sequence:CCGGCGCCACCTATTGTTGTCACTTCTCGAGAAGTGACAACAATAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152219.3-1557s21c1
Sequence:CCGGTGCAACCGTGCACACGAAGAGCTCGAGCTCTTCGTGTGCACGGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152219.3-2192s21c1
Sequence:CCGGGTGCATACACGGACACATAAGCTCGAGCTTATGTGTCCGTGTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152219.3-2080s21c1
Sequence:CCGGGAAGGTGGAGAGTGGTTGTTTCTCGAGAAACAACCACTCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152219
GJD3 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, delta 3, 31.9kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152219.2-1834s1c1
Sequence:CCGGCCCGAACACTATCCATGCTATCTCGAGATAGCATGGATAGTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1441s1c1
Sequence:CCGGCCGTCTTCGTGCTCTTCTATTCTCGAGAATAGAAGAGCACGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1142s1c1
Sequence:CCGGCCCGGTGCTGTTCGTCGTCTACTCGAGTAGACGACGAACAGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1702s1c1
Sequence:CCGGGCTTCCGTAGGGAAAGCACTTCTCGAGAAGTGCTTTCCCTACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152219.2-1606s1c1
Sequence:CCGGCGCCACCTATTGTTGTCACTTCTCGAGAAGTGACAACAATAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152219.3-1557s21c1
Sequence:CCGGTGCAACCGTGCACACGAAGAGCTCGAGCTCTTCGTGTGCACGGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152219.3-2192s21c1
Sequence:CCGGGTGCATACACGGACACATAAGCTCGAGCTTATGTGTCCGTGTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152219.3-2080s21c1
Sequence:CCGGGAAGGTGGAGAGTGGTTGTTTCTCGAGAAACAACCACTCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178596
GJD3 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, delta 3, 31.9kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-144s1c1
Sequence:CCGGGCAGGAGGAGTTCGTGTGTAACTCGAGTTACACACGAACTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-684s1c1
Sequence:CCGGGTCGCCCTCTTTGCCATCGCACTCGAGTGCGATGGCAAAGAGGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-81s1c1
Sequence:CCGGGATCATGCTGATCTTCCGCATCTCGAGATGCGGAAGATCAGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-564s1c1
Sequence:CCGGCGTCTTCGTGGTCTTCTACTTCTCGAGAAGTAGAAGACCACGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-264s1c1
Sequence:CCGGGCCGGTGCTGTTCGTCATCTACTCGAGTAGATGACGAACAGCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178596
GJD3 MISSION shRNA shRNA Plasmid DNA
gap junction protein, delta 3, 31.9kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-144s1c1
Sequence:CCGGGCAGGAGGAGTTCGTGTGTAACTCGAGTTACACACGAACTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-684s1c1
Sequence:CCGGGTCGCCCTCTTTGCCATCGCACTCGAGTGCGATGGCAAAGAGGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-81s1c1
Sequence:CCGGGATCATGCTGATCTTCCGCATCTCGAGATGCGGAAGATCAGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-564s1c1
Sequence:CCGGCGTCTTCGTGGTCTTCTACTTCTCGAGAAGTAGAAGACCACGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-264s1c1
Sequence:CCGGGCCGGTGCTGTTCGTCATCTACTCGAGTAGATGACGAACAGCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178596
GJD3 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, delta 3, 31.9kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-144s1c1
Sequence:CCGGGCAGGAGGAGTTCGTGTGTAACTCGAGTTACACACGAACTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-684s1c1
Sequence:CCGGGTCGCCCTCTTTGCCATCGCACTCGAGTGCGATGGCAAAGAGGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-81s1c1
Sequence:CCGGGATCATGCTGATCTTCCGCATCTCGAGATGCGGAAGATCAGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-564s1c1
Sequence:CCGGCGTCTTCGTGGTCTTCTACTTCTCGAGAAGTAGAAGACCACGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178596.1-264s1c1
Sequence:CCGGGCCGGTGCTGTTCGTCATCTACTCGAGTAGATGACGAACAGCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks