EMAIL THIS PAGE TO A FRIEND

GJD4

gap junction protein, delta 4, 40.1kDa

53 Gene Product Result for
Synonyms: CX40.1 RP11-425A6.2
UniProtKB ID: Q96KN9, Q8N2R7
Gene ID:
Human(219770) Summary: Connexins, such as GJD4, are involved in the formation of gap junctions, intercellular conduits that directly connect the cytoplasms of contacting cells. Each gap junction channel is formed by docking of 2 hemichannels, each of which contains 6 connexin subunits (Sohl et al., 2003 [PubMed 12881038]
Mouse(225152) gap junction protein, delta 4
Rat(266707) gap junction protein, delta 4
chicken(420465) gap junction protein, delta 4, 40.1kDa
cow(522234) gap junction protein, delta 4, 40.1kDa
domestic cat(101100975) gap junction protein, delta 4, 40.1kDa
dog(606949) gap junction delta-4 protein-like
domestic guinea pig(100719223) gap junction protein, delta 4, 40.1kDa
naked mole-rat(101720249) gap junction protein, delta 4, 40.1kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153368 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153368 Rosetta Predictions human pricing
XM_001065136 Rosetta Predictions rat pricing
XM_001068116 Rosetta Predictions rat pricing
NM_153086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180921 predicted 299
2 SASI_Hs01_00180922 predicted 632
3 SASI_Hs01_00180923 predicted 337
4 SASI_Hs01_00180925 predicted 296
5 SASI_Hs01_00180926 predicted 421
6 SASI_Hs01_00180927 predicted 629
7 SASI_Hs01_00180928 predicted 341
8 SASI_Hs01_00180929 predicted 285
9 SASI_Hs01_00180930 predicted 418
10 SASI_Hs02_00367245 predicted 627
11 SASI_Hs01_00180924 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313012 predicted 731
2 SASI_Rn02_00313013 predicted 393
3 SASI_Rn02_00313014 predicted 502
4 SASI_Rn02_00313015 predicted 536
5 SASI_Rn02_00313016 predicted 709
6 SASI_Rn02_00313017 predicted 825
7 SASI_Rn02_00313018 predicted 472
8 SASI_Rn02_00313019 predicted 576
9 SASI_Rn02_00313020 predicted 691
10 SASI_Rn02_00313021 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323502 predicted 737
2 SASI_Rn02_00323503 predicted 394
3 SASI_Rn02_00323504 predicted 496
4 SASI_Rn02_00323505 predicted 533
5 SASI_Rn02_00323506 predicted 710
6 SASI_Rn02_00323507 predicted 816
7 SASI_Rn02_00323508 predicted 471
8 SASI_Rn02_00323509 predicted 576
9 SASI_Rn02_00323510 predicted 687
10 SASI_Rn02_00323511 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342921 predicted 822
2 SASI_Mm02_00342922 predicted 1764
3 SASI_Mm02_00342923 predicted 1714
4 SASI_Mm02_00342924 predicted 694
5 SASI_Mm02_00342925 predicted 358
6 SASI_Mm02_00342926 predicted 702
7 SASI_Mm02_00342927 predicted 982
8 SASI_Mm02_00342928 predicted 324
9 SASI_Mm02_00342929 predicted 1728
10 SASI_Mm02_00342930 predicted 1672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153368
GJD4 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, delta 4, 40.1kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153368.2-298s21c1
Sequence:CCGGACGAGCAGGAGAGGTTTGTCTCTCGAGAGACAAACCTCTCCTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153368.2-1009s21c1
Sequence:CCGGTGTCAGGGCACACGAAGATTCCTCGAGGAATCTTCGTGTGCCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153368.2-1341s21c1
Sequence:CCGGGAGGATCGTTTGAGAATATATCTCGAGATATATTCTCAAACGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153368.1-1305s1c1
Sequence:CCGGCGCCTGTAATCCCAACACTTTCTCGAGAAAGTGTTGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-638s1c1
Sequence:CCGGGCACTACTTTCTCTTTGGATTCTCGAGAATCCAAAGAGAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-633s1c1
Sequence:CCGGGCCTTGCACTACTTTCTCTTTCTCGAGAAAGAGAAAGTAGTGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-344s1c1
Sequence:CCGGCAATGTTTGCTACGACGTCTTCTCGAGAAGACGTCGTAGCAAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-188s1c1
Sequence:CCGGCATCATCACATTAAACTGCAACTCGAGTTGCAGTTTAATGTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153368
GJD4 MISSION shRNA shRNA Plasmid DNA
gap junction protein, delta 4, 40.1kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153368.2-298s21c1
Sequence:CCGGACGAGCAGGAGAGGTTTGTCTCTCGAGAGACAAACCTCTCCTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153368.2-1009s21c1
Sequence:CCGGTGTCAGGGCACACGAAGATTCCTCGAGGAATCTTCGTGTGCCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153368.2-1341s21c1
Sequence:CCGGGAGGATCGTTTGAGAATATATCTCGAGATATATTCTCAAACGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153368.1-1305s1c1
Sequence:CCGGCGCCTGTAATCCCAACACTTTCTCGAGAAAGTGTTGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-638s1c1
Sequence:CCGGGCACTACTTTCTCTTTGGATTCTCGAGAATCCAAAGAGAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-633s1c1
Sequence:CCGGGCCTTGCACTACTTTCTCTTTCTCGAGAAAGAGAAAGTAGTGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-344s1c1
Sequence:CCGGCAATGTTTGCTACGACGTCTTCTCGAGAAGACGTCGTAGCAAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-188s1c1
Sequence:CCGGCATCATCACATTAAACTGCAACTCGAGTTGCAGTTTAATGTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153368
GJD4 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, delta 4, 40.1kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153368.2-298s21c1
Sequence:CCGGACGAGCAGGAGAGGTTTGTCTCTCGAGAGACAAACCTCTCCTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153368.2-1009s21c1
Sequence:CCGGTGTCAGGGCACACGAAGATTCCTCGAGGAATCTTCGTGTGCCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153368.2-1341s21c1
Sequence:CCGGGAGGATCGTTTGAGAATATATCTCGAGATATATTCTCAAACGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153368.1-1305s1c1
Sequence:CCGGCGCCTGTAATCCCAACACTTTCTCGAGAAAGTGTTGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-638s1c1
Sequence:CCGGGCACTACTTTCTCTTTGGATTCTCGAGAATCCAAAGAGAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-633s1c1
Sequence:CCGGGCCTTGCACTACTTTCTCTTTCTCGAGAAAGAGAAAGTAGTGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-344s1c1
Sequence:CCGGCAATGTTTGCTACGACGTCTTCTCGAGAAGACGTCGTAGCAAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153368.1-188s1c1
Sequence:CCGGCATCATCACATTAAACTGCAACTCGAGTTGCAGTTTAATGTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153086
GJD4 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, delta 4, 40.1kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000175164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-331s1c1
Sequence:CCGGGATGAACAAGAGAGGTTTATTCTCGAGAATAAACCTCTCTTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153086.3-2262s1c1
Sequence:CCGGGCTGATTCATAGGATAATCAACTCGAGTTGATTATCCTATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-976s1c1
Sequence:CCGGCAGAGTGACAACAGCAATGTTCTCGAGAACATTGCTGTTGTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-319s1c1
Sequence:CCGGCCTATCTATGAGGATGAACAACTCGAGTTGTTCATCCTCATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153086
GJD4 MISSION shRNA shRNA Plasmid DNA
gap junction protein, delta 4, 40.1kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000175164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-331s1c1
Sequence:CCGGGATGAACAAGAGAGGTTTATTCTCGAGAATAAACCTCTCTTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153086.3-2262s1c1
Sequence:CCGGGCTGATTCATAGGATAATCAACTCGAGTTGATTATCCTATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-976s1c1
Sequence:CCGGCAGAGTGACAACAGCAATGTTCTCGAGAACATTGCTGTTGTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-319s1c1
Sequence:CCGGCCTATCTATGAGGATGAACAACTCGAGTTGTTCATCCTCATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153086
GJD4 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, delta 4, 40.1kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000175164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-331s1c1
Sequence:CCGGGATGAACAAGAGAGGTTTATTCTCGAGAATAAACCTCTCTTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153086.3-2262s1c1
Sequence:CCGGGCTGATTCATAGGATAATCAACTCGAGTTGATTATCCTATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-976s1c1
Sequence:CCGGCAGAGTGACAACAGCAATGTTCTCGAGAACATTGCTGTTGTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153086.3-319s1c1
Sequence:CCGGCCTATCTATGAGGATGAACAACTCGAGTTGTTCATCCTCATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks