EMAIL THIS PAGE TO A FRIEND

GK2

glycerol kinase 2

62 Gene Product Result for
Synonyms: GKP2 GKTA
UniProtKB ID: Q14410, A8K876, Q6PD73, Q86XV8
Gene ID:
Mouse(14626) glycerol kinase 2
Rat(289481) glycerol kinase 2
dog(478448) glycerol kinase 2
domestic cat(101092682) glycerol kinase 2
cow(540143) glycerol kinase 2
Horse(100051712) glycerol kinase 2
domestic guinea pig(100720745) glycerol kinase 2
naked mole-rat(101702878) glycerol kinase 2
sheep(101112820) glycerol kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033214 Rosetta Predictions human pricing
NM_001004077 Rosetta Predictions rat pricing
NM_010294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014080 predicted 1040
2 SASI_Hs01_00014081 predicted 577
3 SASI_Hs01_00014082 predicted 1145
4 SASI_Hs01_00014083 predicted 206
5 SASI_Hs01_00014084 predicted 225
6 SASI_Hs01_00014085 predicted 1635
7 SASI_Hs02_00361009 predicted 1338
8 SASI_Hs01_00014087 predicted 654
9 SASI_Hs01_00014088 predicted 868
10 SASI_Hs01_00014089 predicted 377
11 SASI_Hs01_00014086 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056538 predicted 1139
2 SASI_Rn01_00056539 predicted 654
3 SASI_Rn02_00198102 predicted 1434
4 SASI_Rn01_00056540 predicted 1416
5 SASI_Rn01_00056541 predicted 908
6 SASI_Rn01_00056543 predicted 1622
7 SASI_Rn01_00056544 predicted 488
8 SASI_Rn01_00056546 predicted 1177
9 SASI_Rn02_00198103 predicted 1531
10 SASI_Rn02_00198104 predicted 1467
11 SASI_Rn01_00056542 predicted 1434
12 SASI_Rn01_00056545 predicted 1089
13 SASI_Rn01_00056547 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090001 predicted 1161
2 SASI_Mm01_00090002 predicted 701
3 SASI_Mm02_00318265 predicted 929
4 SASI_Mm01_00090004 predicted 501
5 SASI_Mm01_00090005 predicted 1613
6 SASI_Mm01_00090006 predicted 608
7 SASI_Mm01_00090007 predicted 975
8 SASI_Mm01_00090008 predicted 1020
9 SASI_Mm01_00090009 predicted 1592
10 SASI_Mm01_00090010 predicted 1470
11 SASI_Mm01_00090003 predicted 1361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010294
VALIDATED
GK2 MISSION shRNA Bacterial Glycerol Stock
glycerol kinase 2
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-585s21c1
Sequence:CCGGGTATGACCGGAGGAGTCAATGCTCGAGCATTGACTCCTCCGGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1188s21c1
Sequence:CCGGTCACCAACAAATGCCATATTGCTCGAGCAATATGGCATTTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1354s21c1
Sequence:CCGGTCTGCACATTCCGGTAGTTAACTCGAGTTAACTACCGGAATGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-610s21c1
Sequence:CCGGCATCCATTGCACCGATGTAACCTCGAGGTTACATCGGTGCAATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-258s21c1
Sequence:CCGGCTGAAGTGAACATTGATATTTCTCGAGAAATATCAATGTTCACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1315s21c1
Sequence:GTACCGGGACCAACAACAGGATTCTTATCTCGAGATAAGAATCCTGTTGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1641s21c1
Sequence:CCGGTGAGTAGCATGACGTTATTAACTCGAGTTAATAACGTCATGCTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1472s21c1
Sequence:CCGGACGATCTTGATGGAACGATATCTCGAGATATCGTTCCATCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1025s21c1
Sequence:CCGGCTAAGAGACAATTTCGAAATTCTCGAGAATTTCGAAATTGTCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-431s21c1
Sequence:GTACCGGAGCAACTTTGTCAAGTCTAAGCTCGAGCTTAGACTTGACAAAGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1504s21c1
Sequence:CCGGCCAAGCCACAGAGAGTGAAATCTCGAGATTTCACTCTCTGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-933s21c1
Sequence:CCGGTGACCACATTGGCTTACAAACCTCGAGGTTTGTAAGCCAATGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-984s21c1
Sequence:CCGGTAGAAGGTTCTGTTGCTATAGCTCGAGCTATAGCAACAGAACCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010294.1-609s1c1
Sequence:CCGGGCATCCATTGCACCGATGTAACTCGAGTTACATCGGTGCAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-1640s1c1
Sequence:CCGGGTGAGTAGCATGACGTTATTACTCGAGTAATAACGTCATGCTACTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-149s1c1
Sequence:CCGGCAGGTGGAACTGACACAAGAACTCGAGTTCTTGTGTCAGTTCCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-1343s1c1
Sequence:CCGGCAGGCAGATATTCTGCACATTCTCGAGAATGTGCAGAATATCTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-257s1c1
Sequence:CCGGGCTGAAGTGAACATTGATATTCTCGAGAATATCAATGTTCACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010294
VALIDATED
GK2 MISSION shRNA shRNA Plasmid DNA
glycerol kinase 2
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-585s21c1
Sequence:CCGGGTATGACCGGAGGAGTCAATGCTCGAGCATTGACTCCTCCGGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1188s21c1
Sequence:CCGGTCACCAACAAATGCCATATTGCTCGAGCAATATGGCATTTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1354s21c1
Sequence:CCGGTCTGCACATTCCGGTAGTTAACTCGAGTTAACTACCGGAATGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-610s21c1
Sequence:CCGGCATCCATTGCACCGATGTAACCTCGAGGTTACATCGGTGCAATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-258s21c1
Sequence:CCGGCTGAAGTGAACATTGATATTTCTCGAGAAATATCAATGTTCACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1315s21c1
Sequence:GTACCGGGACCAACAACAGGATTCTTATCTCGAGATAAGAATCCTGTTGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1641s21c1
Sequence:CCGGTGAGTAGCATGACGTTATTAACTCGAGTTAATAACGTCATGCTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1472s21c1
Sequence:CCGGACGATCTTGATGGAACGATATCTCGAGATATCGTTCCATCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1025s21c1
Sequence:CCGGCTAAGAGACAATTTCGAAATTCTCGAGAATTTCGAAATTGTCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-431s21c1
Sequence:GTACCGGAGCAACTTTGTCAAGTCTAAGCTCGAGCTTAGACTTGACAAAGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1504s21c1
Sequence:CCGGCCAAGCCACAGAGAGTGAAATCTCGAGATTTCACTCTCTGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-933s21c1
Sequence:CCGGTGACCACATTGGCTTACAAACCTCGAGGTTTGTAAGCCAATGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-984s21c1
Sequence:CCGGTAGAAGGTTCTGTTGCTATAGCTCGAGCTATAGCAACAGAACCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010294.1-609s1c1
Sequence:CCGGGCATCCATTGCACCGATGTAACTCGAGTTACATCGGTGCAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-1640s1c1
Sequence:CCGGGTGAGTAGCATGACGTTATTACTCGAGTAATAACGTCATGCTACTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-149s1c1
Sequence:CCGGCAGGTGGAACTGACACAAGAACTCGAGTTCTTGTGTCAGTTCCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-1343s1c1
Sequence:CCGGCAGGCAGATATTCTGCACATTCTCGAGAATGTGCAGAATATCTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-257s1c1
Sequence:CCGGGCTGAAGTGAACATTGATATTCTCGAGAATATCAATGTTCACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010294
VALIDATED
GK2 MISSION shRNA Lentiviral Transduction Particles
glycerol kinase 2
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-585s21c1
Sequence:CCGGGTATGACCGGAGGAGTCAATGCTCGAGCATTGACTCCTCCGGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1188s21c1
Sequence:CCGGTCACCAACAAATGCCATATTGCTCGAGCAATATGGCATTTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1354s21c1
Sequence:CCGGTCTGCACATTCCGGTAGTTAACTCGAGTTAACTACCGGAATGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-610s21c1
Sequence:CCGGCATCCATTGCACCGATGTAACCTCGAGGTTACATCGGTGCAATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-258s21c1
Sequence:CCGGCTGAAGTGAACATTGATATTTCTCGAGAAATATCAATGTTCACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1315s21c1
Sequence:GTACCGGGACCAACAACAGGATTCTTATCTCGAGATAAGAATCCTGTTGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1641s21c1
Sequence:CCGGTGAGTAGCATGACGTTATTAACTCGAGTTAATAACGTCATGCTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1472s21c1
Sequence:CCGGACGATCTTGATGGAACGATATCTCGAGATATCGTTCCATCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1025s21c1
Sequence:CCGGCTAAGAGACAATTTCGAAATTCTCGAGAATTTCGAAATTGTCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-431s21c1
Sequence:GTACCGGAGCAACTTTGTCAAGTCTAAGCTCGAGCTTAGACTTGACAAAGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-1504s21c1
Sequence:CCGGCCAAGCCACAGAGAGTGAAATCTCGAGATTTCACTCTCTGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-933s21c1
Sequence:CCGGTGACCACATTGGCTTACAAACCTCGAGGTTTGTAAGCCAATGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010294.1-984s21c1
Sequence:CCGGTAGAAGGTTCTGTTGCTATAGCTCGAGCTATAGCAACAGAACCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010294.1-609s1c1
Sequence:CCGGGCATCCATTGCACCGATGTAACTCGAGTTACATCGGTGCAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-1640s1c1
Sequence:CCGGGTGAGTAGCATGACGTTATTACTCGAGTAATAACGTCATGCTACTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-149s1c1
Sequence:CCGGCAGGTGGAACTGACACAAGAACTCGAGTTCTTGTGTCAGTTCCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-1343s1c1
Sequence:CCGGCAGGCAGATATTCTGCACATTCTCGAGAATGTGCAGAATATCTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010294.1-257s1c1
Sequence:CCGGGCTGAAGTGAACATTGATATTCTCGAGAATATCAATGTTCACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033214
GK2 MISSION shRNA Bacterial Glycerol Stock
glycerol kinase 2
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-418s21c1
Sequence:CCGGAGTAACTTCGTCAAGTCTAAGCTCGAGCTTAGACTTGACGAAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033214.2-1691s21c1
Sequence:GTACCGGTATGGAGTCCCAAGATGTAAACTCGAGTTTACATCTTGGGACTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-1663s21c1
Sequence:CCGGATCTCGGGTGTGCCATAATAACTCGAGTTATTATGGCACACCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-876s21c1
Sequence:CCGGGTGTAATACGGGTCGTAAATGCTCGAGCATTTACGACCCGTATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-243s21c1
Sequence:CCGGTGACGAACTGAATATTGATATCTCGAGATATCAATATTCAGTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-378s21c1
Sequence:CCGGGACTACTGTTGAGGATCTTAGCTCGAGCTAAGATCCTCAACAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-946s21c1
Sequence:CCGGAGAGAGAAGCCAGCATATTATCTCGAGATAATATGCTGGCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033214.2-1717s21c1
Sequence:CCGGTACATAATGAAAGCATATAGCCTCGAGGCTATATGCTTTCATTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1496s1c1
Sequence:CCGGCCACAGAAAGTGAAATTCGTTCTCGAGAACGAATTTCACTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-596s1c1
Sequence:CCGGGCGTGCATTGTACAGATGTAACTCGAGTTACATCTGTACAATGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-800s1c1
Sequence:CCGGGTGCTGCATTAGTAGGACAAACTCGAGTTTGTCCTACTAATGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1273s1c1
Sequence:CCGGCTTCGTCATTTGCAGGTAGATCTCGAGATCTACCTGCAAATGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-235s1c1
Sequence:CCGGGAGAAACTTGACGAACTGAATCTCGAGATTCAGTTCGTCAAGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1654s1c1
Sequence:CCGGGCAAGATATATCTCGGGTGTGCTCGAGCACACCCGAGATATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1164s1c1
Sequence:CCGGCCTCACTCAGTTTACCAATAACTCGAGTTATTGGTAAACTGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-728s1c1
Sequence:CCGGCTGAGATCTATGGCCTAATTACTCGAGTAATTAGGCCATAGATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033214.2-1736s1c1
Sequence:CCGGGCAGTTCTGCCTCTTAATATACTCGAGTATATTAAGAGGCAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-688s1c1
Sequence:CCGGGAAATTCCAATGGACCTTCTTCTCGAGAAGAAGGTCCATTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033214
GK2 MISSION shRNA shRNA Plasmid DNA
glycerol kinase 2
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-418s21c1
Sequence:CCGGAGTAACTTCGTCAAGTCTAAGCTCGAGCTTAGACTTGACGAAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033214.2-1691s21c1
Sequence:GTACCGGTATGGAGTCCCAAGATGTAAACTCGAGTTTACATCTTGGGACTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-1663s21c1
Sequence:CCGGATCTCGGGTGTGCCATAATAACTCGAGTTATTATGGCACACCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-876s21c1
Sequence:CCGGGTGTAATACGGGTCGTAAATGCTCGAGCATTTACGACCCGTATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-243s21c1
Sequence:CCGGTGACGAACTGAATATTGATATCTCGAGATATCAATATTCAGTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-378s21c1
Sequence:CCGGGACTACTGTTGAGGATCTTAGCTCGAGCTAAGATCCTCAACAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-946s21c1
Sequence:CCGGAGAGAGAAGCCAGCATATTATCTCGAGATAATATGCTGGCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033214.2-1717s21c1
Sequence:CCGGTACATAATGAAAGCATATAGCCTCGAGGCTATATGCTTTCATTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1496s1c1
Sequence:CCGGCCACAGAAAGTGAAATTCGTTCTCGAGAACGAATTTCACTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-596s1c1
Sequence:CCGGGCGTGCATTGTACAGATGTAACTCGAGTTACATCTGTACAATGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-800s1c1
Sequence:CCGGGTGCTGCATTAGTAGGACAAACTCGAGTTTGTCCTACTAATGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1273s1c1
Sequence:CCGGCTTCGTCATTTGCAGGTAGATCTCGAGATCTACCTGCAAATGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-235s1c1
Sequence:CCGGGAGAAACTTGACGAACTGAATCTCGAGATTCAGTTCGTCAAGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1654s1c1
Sequence:CCGGGCAAGATATATCTCGGGTGTGCTCGAGCACACCCGAGATATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1164s1c1
Sequence:CCGGCCTCACTCAGTTTACCAATAACTCGAGTTATTGGTAAACTGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-728s1c1
Sequence:CCGGCTGAGATCTATGGCCTAATTACTCGAGTAATTAGGCCATAGATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033214.2-1736s1c1
Sequence:CCGGGCAGTTCTGCCTCTTAATATACTCGAGTATATTAAGAGGCAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-688s1c1
Sequence:CCGGGAAATTCCAATGGACCTTCTTCTCGAGAAGAAGGTCCATTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033214
GK2 MISSION shRNA Lentiviral Transduction Particles
glycerol kinase 2
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-418s21c1
Sequence:CCGGAGTAACTTCGTCAAGTCTAAGCTCGAGCTTAGACTTGACGAAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033214.2-1691s21c1
Sequence:GTACCGGTATGGAGTCCCAAGATGTAAACTCGAGTTTACATCTTGGGACTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-1663s21c1
Sequence:CCGGATCTCGGGTGTGCCATAATAACTCGAGTTATTATGGCACACCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-876s21c1
Sequence:CCGGGTGTAATACGGGTCGTAAATGCTCGAGCATTTACGACCCGTATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-243s21c1
Sequence:CCGGTGACGAACTGAATATTGATATCTCGAGATATCAATATTCAGTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-378s21c1
Sequence:CCGGGACTACTGTTGAGGATCTTAGCTCGAGCTAAGATCCTCAACAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033214.2-946s21c1
Sequence:CCGGAGAGAGAAGCCAGCATATTATCTCGAGATAATATGCTGGCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033214.2-1717s21c1
Sequence:CCGGTACATAATGAAAGCATATAGCCTCGAGGCTATATGCTTTCATTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1496s1c1
Sequence:CCGGCCACAGAAAGTGAAATTCGTTCTCGAGAACGAATTTCACTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-596s1c1
Sequence:CCGGGCGTGCATTGTACAGATGTAACTCGAGTTACATCTGTACAATGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-800s1c1
Sequence:CCGGGTGCTGCATTAGTAGGACAAACTCGAGTTTGTCCTACTAATGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1273s1c1
Sequence:CCGGCTTCGTCATTTGCAGGTAGATCTCGAGATCTACCTGCAAATGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-235s1c1
Sequence:CCGGGAGAAACTTGACGAACTGAATCTCGAGATTCAGTTCGTCAAGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1654s1c1
Sequence:CCGGGCAAGATATATCTCGGGTGTGCTCGAGCACACCCGAGATATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-1164s1c1
Sequence:CCGGCCTCACTCAGTTTACCAATAACTCGAGTTATTGGTAAACTGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-728s1c1
Sequence:CCGGCTGAGATCTATGGCCTAATTACTCGAGTAATTAGGCCATAGATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033214.2-1736s1c1
Sequence:CCGGGCAGTTCTGCCTCTTAATATACTCGAGTATATTAAGAGGCAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033214.2-688s1c1
Sequence:CCGGGAAATTCCAATGGACCTTCTTCTCGAGAAGAAGGTCCATTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks