EMAIL THIS PAGE TO A FRIEND

GK5

glycerol kinase 5 (putative)

UniProtKB ID: Q6ZS86, B2R9I2, D3DNG2, Q8N2A7, Q8N5E6
Gene ID:
Mouse(235533) glycerol kinase 5 (putative)
Rat(367146) glycerol kinase 5 (putative)
Zebrafish(777765) glycerol kinase 5 (putative)
chicken(424779) glycerol kinase 5 (putative)
domestic cat(101097341) glycerol kinase 5 (putative)
cow(616031) glycerol kinase 5 (putative)
dog(485695) glycerol kinase 5 (putative)
sheep(101107065) glycerol kinase 5 (putative)
domestic guinea pig(100732139) glycerol kinase 5 (putative)
naked mole-rat(101700083) glycerol kinase 5 (putative)
221 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152776 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039547 Rosetta Predictions human pricing
XM_001069076 Rosetta Predictions rat pricing
XM_345971 Rosetta Predictions rat pricing
NM_177352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162567 predicted 1107
2 SASI_Hs01_00162568 predicted 1323
3 SASI_Hs01_00162570 predicted 372
4 SASI_Hs01_00162571 predicted 330
5 SASI_Hs01_00162572 predicted 1472
6 SASI_Hs01_00162574 predicted 721
7 SASI_Hs01_00162575 predicted 528
8 SASI_Hs01_00162576 predicted 712
9 SASI_Hs02_00308556 predicted 1307
10 SASI_Hs02_00308557 predicted 1223
11 SASI_Hs01_00162569 predicted 487
12 SASI_Hs01_00162573 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326820 predicted 468
2 SASI_Rn02_00326821 predicted 590
3 SASI_Rn02_00326822 predicted 1536
4 SASI_Rn02_00326823 predicted 593
5 SASI_Rn02_00326824 predicted 1427
6 SASI_Rn02_00326825 predicted 1317
7 SASI_Rn02_00326826 predicted 487
8 SASI_Rn02_00326827 predicted 1277
9 SASI_Rn02_00326828 predicted 1437
10 SASI_Rn02_00326829 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398932 predicted 468
2 SASI_Rn02_00398933 predicted 595
3 SASI_Rn02_00398934 predicted 1540
4 SASI_Rn02_00398935 predicted 595
5 SASI_Rn02_00398936 predicted 1430
6 SASI_Rn02_00398937 predicted 1316
7 SASI_Rn02_00398938 predicted 488
8 SASI_Rn02_00398939 predicted 1272
9 SASI_Rn02_00398940 predicted 1436
10 SASI_Rn02_00398941 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347485 predicted 1219
2 SASI_Mm02_00347486 predicted 961
3 SASI_Mm02_00347487 predicted 1274
4 SASI_Mm02_00347488 predicted 415
5 SASI_Mm02_00347489 predicted 1260
6 SASI_Mm02_00347490 predicted 730
7 SASI_Mm02_00347491 predicted 659
8 SASI_Mm02_00347492 predicted 294
9 SASI_Mm02_00347493 predicted 1353
10 SASI_Mm02_00347494 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152776
VALIDATED
GK5 MISSION shRNA Bacterial Glycerol Stock
glycerol kinase 5 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152776.1-356s1c1
Sequence:CCGGGCAGGAATACAGATGAATCAACTCGAGTTGATTCATCTGTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_152776.1-937s1c1
Sequence:CCGGCCCTGGATATGACCAGAATATCTCGAGATATTCTGGTCATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152776.1-1237s1c1
Sequence:CCGGGCCATCATCTACCAGTAAATACTCGAGTATTTACTGGTAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152776.1-935s1c1
Sequence:CCGGGTCCCTGGATATGACCAGAATCTCGAGATTCTGGTCATATCCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152776.1-302s1c1
Sequence:CCGGCCTGATGTTCTTTGGATTCAACTCGAGTTGAATCCAAAGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152776
VALIDATED
GK5 MISSION shRNA shRNA Plasmid DNA
glycerol kinase 5 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152776.1-356s1c1
Sequence:CCGGGCAGGAATACAGATGAATCAACTCGAGTTGATTCATCTGTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_152776.1-937s1c1
Sequence:CCGGCCCTGGATATGACCAGAATATCTCGAGATATTCTGGTCATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152776.1-1237s1c1
Sequence:CCGGGCCATCATCTACCAGTAAATACTCGAGTATTTACTGGTAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152776.1-935s1c1
Sequence:CCGGGTCCCTGGATATGACCAGAATCTCGAGATTCTGGTCATATCCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152776.1-302s1c1
Sequence:CCGGCCTGATGTTCTTTGGATTCAACTCGAGTTGAATCCAAAGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152776
VALIDATED
GK5 MISSION shRNA Lentiviral Transduction Particles
glycerol kinase 5 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152776.1-356s1c1
Sequence:CCGGGCAGGAATACAGATGAATCAACTCGAGTTGATTCATCTGTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_152776.1-937s1c1
Sequence:CCGGCCCTGGATATGACCAGAATATCTCGAGATATTCTGGTCATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152776.1-1237s1c1
Sequence:CCGGGCCATCATCTACCAGTAAATACTCGAGTATTTACTGGTAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152776.1-935s1c1
Sequence:CCGGGTCCCTGGATATGACCAGAATCTCGAGATTCTGGTCATATCCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152776.1-302s1c1
Sequence:CCGGCCTGATGTTCTTTGGATTCAACTCGAGTTGAATCCAAAGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177352
GK5 MISSION shRNA Bacterial Glycerol Stock
glycerol kinase 5 (putative)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-424s1c1
Sequence:CCGGCCTGGAATAATTCTCTCATAACTCGAGTTATGAGAGAATTATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-243s1c1
Sequence:CCGGGCTCAGTTTGTTGCCGTAATACTCGAGTATTACGGCAACAAACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-1256s1c1
Sequence:CCGGCCGAGCAATATTGGAGTCAATCTCGAGATTGACTCCAATATTGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-1395s1c1
Sequence:CCGGGACCTGATAAATGAGAAGATACTCGAGTATCTTCTCATTTATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-635s1c1
Sequence:CCGGGCTGTTATACAAGCTCACGAACTCGAGTTCGTGAGCTTGTATAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-243s21c1
Sequence:CCGGCTCAGTTTGTTGCCGTAATAACTCGAGTTATTACGGCAACAAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-780s21c1
Sequence:CCGGTGAAGGATACCAGCTATAATTCTCGAGAATTATAGCTGGTATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-660s21c1
Sequence:CCGGCTTCCTACGCCACGGATTATTCTCGAGAATAATCCGTGGCGTAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177352
GK5 MISSION shRNA shRNA Plasmid DNA
glycerol kinase 5 (putative)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-424s1c1
Sequence:CCGGCCTGGAATAATTCTCTCATAACTCGAGTTATGAGAGAATTATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-243s1c1
Sequence:CCGGGCTCAGTTTGTTGCCGTAATACTCGAGTATTACGGCAACAAACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-1256s1c1
Sequence:CCGGCCGAGCAATATTGGAGTCAATCTCGAGATTGACTCCAATATTGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-1395s1c1
Sequence:CCGGGACCTGATAAATGAGAAGATACTCGAGTATCTTCTCATTTATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-635s1c1
Sequence:CCGGGCTGTTATACAAGCTCACGAACTCGAGTTCGTGAGCTTGTATAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-243s21c1
Sequence:CCGGCTCAGTTTGTTGCCGTAATAACTCGAGTTATTACGGCAACAAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-780s21c1
Sequence:CCGGTGAAGGATACCAGCTATAATTCTCGAGAATTATAGCTGGTATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-660s21c1
Sequence:CCGGCTTCCTACGCCACGGATTATTCTCGAGAATAATCCGTGGCGTAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177352
GK5 MISSION shRNA Lentiviral Transduction Particles
glycerol kinase 5 (putative)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-424s1c1
Sequence:CCGGCCTGGAATAATTCTCTCATAACTCGAGTTATGAGAGAATTATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-243s1c1
Sequence:CCGGGCTCAGTTTGTTGCCGTAATACTCGAGTATTACGGCAACAAACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-1256s1c1
Sequence:CCGGCCGAGCAATATTGGAGTCAATCTCGAGATTGACTCCAATATTGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-1395s1c1
Sequence:CCGGGACCTGATAAATGAGAAGATACTCGAGTATCTTCTCATTTATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177352.2-635s1c1
Sequence:CCGGGCTGTTATACAAGCTCACGAACTCGAGTTCGTGAGCTTGTATAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-243s21c1
Sequence:CCGGCTCAGTTTGTTGCCGTAATAACTCGAGTTATTACGGCAACAAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-780s21c1
Sequence:CCGGTGAAGGATACCAGCTATAATTCTCGAGAATTATAGCTGGTATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177352.4-660s21c1
Sequence:CCGGCTTCCTACGCCACGGATTATTCTCGAGAATAATCCGTGGCGTAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039547
VALIDATED
GK5 MISSION shRNA Bacterial Glycerol Stock
glycerol kinase 5 (putative)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-1265s21c1
Sequence:CCGGTGGATTACAGGCTCCATTAAACTCGAGTTTAATGGAGCCTGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-718s21c1
Sequence:CCGGTTGATACCTGGTTGTTATATACTCGAGTATATAACAACCAGGTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-1317s21c1
Sequence:CCGGTTGAAGCCTTCTACCAGTAAACTCGAGTTTACTGGTAGAAGGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039547.1-1479s21c1
Sequence:CCGGATGACTTCAGACCTGATTAATCTCGAGATTAATCAGGTCTGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039547.1-337s21c1
Sequence:CCGGTTCAATTTGTTGCCGTAATAACTCGAGTTATTACGGCAACAAATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039547.1-1961s21c1
Sequence:CCGGTCCAAAGGACATTAGTCATTTCTCGAGAAATGACTAATGTCCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039547
VALIDATED
GK5 MISSION shRNA shRNA Plasmid DNA
glycerol kinase 5 (putative)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-1265s21c1
Sequence:CCGGTGGATTACAGGCTCCATTAAACTCGAGTTTAATGGAGCCTGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-718s21c1
Sequence:CCGGTTGATACCTGGTTGTTATATACTCGAGTATATAACAACCAGGTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-1317s21c1
Sequence:CCGGTTGAAGCCTTCTACCAGTAAACTCGAGTTTACTGGTAGAAGGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039547.1-1479s21c1
Sequence:CCGGATGACTTCAGACCTGATTAATCTCGAGATTAATCAGGTCTGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039547.1-337s21c1
Sequence:CCGGTTCAATTTGTTGCCGTAATAACTCGAGTTATTACGGCAACAAATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039547.1-1961s21c1
Sequence:CCGGTCCAAAGGACATTAGTCATTTCTCGAGAAATGACTAATGTCCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039547
VALIDATED
GK5 MISSION shRNA Lentiviral Transduction Particles
glycerol kinase 5 (putative)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-1265s21c1
Sequence:CCGGTGGATTACAGGCTCCATTAAACTCGAGTTTAATGGAGCCTGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-718s21c1
Sequence:CCGGTTGATACCTGGTTGTTATATACTCGAGTATATAACAACCAGGTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039547.1-1317s21c1
Sequence:CCGGTTGAAGCCTTCTACCAGTAAACTCGAGTTTACTGGTAGAAGGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039547.1-1479s21c1
Sequence:CCGGATGACTTCAGACCTGATTAATCTCGAGATTAATCAGGTCTGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039547.1-337s21c1
Sequence:CCGGTTCAATTTGTTGCCGTAATAACTCGAGTTATTACGGCAACAAATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039547.1-1961s21c1
Sequence:CCGGTCCAAAGGACATTAGTCATTTCTCGAGAAATGACTAATGTCCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks