EMAIL THIS PAGE TO A FRIEND

GK

glycerol kinase

144 Gene Product Result for
Synonyms: GK1 GKD
Gene ID:
Human(2710) Summary: The protein encoded by this gene belongs to the FGGY kinase family. This protein is a key enzyme in the regulation of glycerol uptake and metabolism. It catalyzes the phosphorylation of glycerol by ATP, yielding ADP and glycerol-3-phosphate. Mutations in this gene are associated with glycerol kinase deficiency (GKD). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Rat(79223) glycerol kinase
cow(505987) glycerol kinase
domestic cat(101101114) glycerol kinase
dog(480872) glycerol kinase
fruit fly(38221) CG7995 gene product from transcript CG7995-RC
chicken(418589) glycerol kinase
sheep(101118587) glycerol kinase
naked mole-rat(101719372) glycerol kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000167 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127971 MISSION® esiRNA esiRNA human GK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000167 Rosetta Predictions human pricing
NM_203391 Rosetta Predictions human pricing
NM_024381 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301998 predicted 1727
2 SASI_Hs01_00037134 predicted 330
3 SASI_Hs01_00037135 predicted 304
4 SASI_Hs01_00037136 predicted 308
5 SASI_Hs01_00037137 predicted 287
6 SASI_Hs01_00037138 predicted 410
7 SASI_Hs01_00037139 predicted 303
8 SASI_Hs01_00037140 predicted 327
9 SASI_Hs01_00037141 predicted 1570
10 SASI_Hs01_00037142 predicted 1245
11 SASI_Hs01_00037143 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373322 predicted 1753
2 SASI_Hs01_00036546 predicted 339
3 SASI_Hs01_00036547 predicted 306
4 SASI_Hs01_00036548 predicted 299
5 SASI_Hs01_00036549 predicted 288
6 SASI_Hs01_00036550 predicted 403
7 SASI_Hs01_00036551 predicted 303
8 SASI_Hs01_00036552 predicted 327
9 SASI_Hs01_00036553 predicted 1592
10 SASI_Hs01_00036554 predicted 1266
11 SASI_Hs01_00036555 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034632 predicted 1607
2 SASI_Rn01_00034633 predicted 310
3 SASI_Rn01_00034634 predicted 380
4 SASI_Rn02_00263976 predicted 616
5 SASI_Rn01_00034635 predicted 1651
6 SASI_Rn01_00034636 predicted 275
7 SASI_Rn01_00034637 predicted 1000
8 SASI_Rn02_00263977 predicted 475
9 SASI_Rn01_00034638 predicted 1022
10 SASI_Rn01_00034639 predicted 1551
11 SASI_Rn01_00034640 predicted 1164
12 SASI_Rn01_00034641 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000167
VALIDATED
GK MISSION shRNA Bacterial Glycerol Stock
glycerol kinase
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-643s1c1
Sequence:CCGGGACTATTGATTCATGGCTTATCTCGAGATAAGCCATGAATCAATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-2559s1c1
Sequence:CCGGGCAACGGTTATGCATAATATTCTCGAGAATATTATGCATAACCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-3396s1c1
Sequence:CCGGGTAGGTTGAGTTCATTGTAAACTCGAGTTTACAATGAACTCAACCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-221s1c1
Sequence:CCGGCTTAGTCATCATCAAGTAGAACTCGAGTTCTACTTGATGATGACTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-1760s1c1
Sequence:CCGGCTTAATGCAATGACACTATTCCTCGAGGAATAGTGTCATTGCATTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-1745s1c1
Sequence:CCGGCCAGCAATTCTGTCTCTTAATCTCGAGATTAAGAGACAGAATTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-761s1c1
Sequence:CCGGGATAAACAACTCTGCGAATTTCTCGAGAAATTCGCAGAGTTGTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-212s1c1
Sequence:CCGGGCTGAACTACTTAGTCATCATCTCGAGATGATGACTAAGTAGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-814s1c1
Sequence:CCGGCCGGAGTTCTTCTGAGATCTACTCGAGTAGATCTCAGAAGAACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000167.3-1447s1c1
Sequence:CCGGACCAGTAGTGAAGCCCTCAATCTCGAGATTGAGGGCTTCACTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-298s1c1
Sequence:CCGGACATTCTGTCTATGAGTGTATCTCGAGATACACTCATAGACAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-1016s1c1
Sequence:CCGGCTCACCACAGTGGCTTACAAACTCGAGTTTGTAAGCCACTGTGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-1161s1c1
Sequence:CCGGCTAAAGAAGTAGGTACTTCTTCTCGAGAAGAAGTACCTACTTCTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000167.4-2623s21c1
Sequence:CCGGGCAACGGTTATGCATAATATTCTCGAGAATATTATGCATAACCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-825s21c1
Sequence:CCGGGATAAACAACTCTGCGAATTTCTCGAGAAATTCGCAGAGTTGTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000167.4-1809s21c1
Sequence:CCGGCCAGCAATTCTGTCTCTTAATCTCGAGATTAAGAGACAGAATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-1728s21c1
Sequence:CCGGCAATCTCCAGAAAGTGGTATTCTCGAGAATACCACTTTCTGGAGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-362s21c1
Sequence:CCGGACATTCTGTCTATGAGTGTATCTCGAGATACACTCATAGACAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000167
VALIDATED
GK MISSION shRNA shRNA Plasmid DNA
glycerol kinase
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-643s1c1
Sequence:CCGGGACTATTGATTCATGGCTTATCTCGAGATAAGCCATGAATCAATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-2559s1c1
Sequence:CCGGGCAACGGTTATGCATAATATTCTCGAGAATATTATGCATAACCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-3396s1c1
Sequence:CCGGGTAGGTTGAGTTCATTGTAAACTCGAGTTTACAATGAACTCAACCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-221s1c1
Sequence:CCGGCTTAGTCATCATCAAGTAGAACTCGAGTTCTACTTGATGATGACTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-1760s1c1
Sequence:CCGGCTTAATGCAATGACACTATTCCTCGAGGAATAGTGTCATTGCATTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-1745s1c1
Sequence:CCGGCCAGCAATTCTGTCTCTTAATCTCGAGATTAAGAGACAGAATTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-761s1c1
Sequence:CCGGGATAAACAACTCTGCGAATTTCTCGAGAAATTCGCAGAGTTGTTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-212s1c1
Sequence:CCGGGCTGAACTACTTAGTCATCATCTCGAGATGATGACTAAGTAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-814s1c1
Sequence:CCGGCCGGAGTTCTTCTGAGATCTACTCGAGTAGATCTCAGAAGAACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000167.3-1447s1c1
Sequence:CCGGACCAGTAGTGAAGCCCTCAATCTCGAGATTGAGGGCTTCACTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-298s1c1
Sequence:CCGGACATTCTGTCTATGAGTGTATCTCGAGATACACTCATAGACAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-1016s1c1
Sequence:CCGGCTCACCACAGTGGCTTACAAACTCGAGTTTGTAAGCCACTGTGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-1161s1c1
Sequence:CCGGCTAAAGAAGTAGGTACTTCTTCTCGAGAAGAAGTACCTACTTCTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000167.4-2623s21c1
Sequence:CCGGGCAACGGTTATGCATAATATTCTCGAGAATATTATGCATAACCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-825s21c1
Sequence:CCGGGATAAACAACTCTGCGAATTTCTCGAGAAATTCGCAGAGTTGTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000167.4-1809s21c1
Sequence:CCGGCCAGCAATTCTGTCTCTTAATCTCGAGATTAAGAGACAGAATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-1728s21c1
Sequence:CCGGCAATCTCCAGAAAGTGGTATTCTCGAGAATACCACTTTCTGGAGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-362s21c1
Sequence:CCGGACATTCTGTCTATGAGTGTATCTCGAGATACACTCATAGACAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000167
VALIDATED
GK MISSION shRNA Lentiviral Transduction Particles
glycerol kinase
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-643s1c1
Sequence:CCGGGACTATTGATTCATGGCTTATCTCGAGATAAGCCATGAATCAATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-2559s1c1
Sequence:CCGGGCAACGGTTATGCATAATATTCTCGAGAATATTATGCATAACCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-3396s1c1
Sequence:CCGGGTAGGTTGAGTTCATTGTAAACTCGAGTTTACAATGAACTCAACCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-221s1c1
Sequence:CCGGCTTAGTCATCATCAAGTAGAACTCGAGTTCTACTTGATGATGACTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-1760s1c1
Sequence:CCGGCTTAATGCAATGACACTATTCCTCGAGGAATAGTGTCATTGCATTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000167.3-1745s1c1
Sequence:CCGGCCAGCAATTCTGTCTCTTAATCTCGAGATTAAGAGACAGAATTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-761s1c1
Sequence:CCGGGATAAACAACTCTGCGAATTTCTCGAGAAATTCGCAGAGTTGTTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000167.3-212s1c1
Sequence:CCGGGCTGAACTACTTAGTCATCATCTCGAGATGATGACTAAGTAGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-814s1c1
Sequence:CCGGCCGGAGTTCTTCTGAGATCTACTCGAGTAGATCTCAGAAGAACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000167.3-1447s1c1
Sequence:CCGGACCAGTAGTGAAGCCCTCAATCTCGAGATTGAGGGCTTCACTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-298s1c1
Sequence:CCGGACATTCTGTCTATGAGTGTATCTCGAGATACACTCATAGACAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-1016s1c1
Sequence:CCGGCTCACCACAGTGGCTTACAAACTCGAGTTTGTAAGCCACTGTGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000167.3-1161s1c1
Sequence:CCGGCTAAAGAAGTAGGTACTTCTTCTCGAGAAGAAGTACCTACTTCTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000167.4-2623s21c1
Sequence:CCGGGCAACGGTTATGCATAATATTCTCGAGAATATTATGCATAACCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-825s21c1
Sequence:CCGGGATAAACAACTCTGCGAATTTCTCGAGAAATTCGCAGAGTTGTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000167.4-1809s21c1
Sequence:CCGGCCAGCAATTCTGTCTCTTAATCTCGAGATTAAGAGACAGAATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-1728s21c1
Sequence:CCGGCAATCTCCAGAAAGTGGTATTCTCGAGAATACCACTTTCTGGAGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000167.4-362s21c1
Sequence:CCGGACATTCTGTCTATGAGTGTATCTCGAGATACACTCATAGACAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)