EMAIL THIS PAGE TO A FRIEND

GKAP1

G kinase anchoring protein 1

78 Gene Product Result for
Synonyms: GKAP42
UniProtKB ID: Q5VSY0, Q96LI0, Q9BYI1, Q9BYI2, Q9H225
Gene ID:
Human(80318) Summary: This gene encodes a protein that is highly similar to the mouse cGMP-dependent protein kinase anchoring protein 42kDa. The mouse protein has been found to localize with the Golgi and recruit cGMP-dependent protein kinase I alpha to the Golgi in mouse testes. It is thought to play a role in germ cell development. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(56278) G kinase anchoring protein 1
Rat(361202) G kinase anchoring protein 1
Zebrafish(406581) G kinase anchoring protein 1
cow(613960) G kinase anchoring protein 1
domestic cat(101099157) G kinase anchoring protein 1
dog(476311) G kinase anchoring protein 1
chicken(427455) G kinase anchoring protein 1
domestic guinea pig(100725230) G kinase anchoring protein 1
naked mole-rat(101714814) G kinase anchoring protein 1
sheep(101119016) G kinase anchoring protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025211 Rosetta Predictions human pricing
NM_001012160 Rosetta Predictions rat pricing
XM_573979 Rosetta Predictions rat pricing
NM_019832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357988 predicted 832
2 SASI_Hs01_00042252 predicted 1260
3 SASI_Hs01_00042253 predicted 1087
4 SASI_Hs01_00042254 predicted 832
5 SASI_Hs01_00042255 predicted 1401
6 SASI_Hs01_00042256 predicted 1101
7 SASI_Hs01_00042257 predicted 1008
8 SASI_Hs01_00042259 predicted 1333
9 SASI_Hs01_00042260 predicted 859
10 SASI_Hs01_00042261 predicted 1000
11 SASI_Hs01_00042258 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094281 predicted 704
2 SASI_Rn01_00094283 predicted 1074
3 SASI_Rn02_00200349 predicted 795
4 SASI_Rn02_00200350 predicted 1229
5 SASI_Rn01_00094284 predicted 759
6 SASI_Rn02_00200351 predicted 424
7 SASI_Rn01_00094285 predicted 1206
8 SASI_Rn01_00094286 predicted 970
9 SASI_Rn01_00094287 predicted 960
10 SASI_Rn01_00094288 predicted 857
11 SASI_Rn01_00094280 predicted 1351
12 SASI_Rn01_00094282 predicted 467
13 SASI_Rn01_00094289 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141684 predicted 1348
2 SASI_Rn01_00141685 predicted 709
3 SASI_Rn01_00141686 predicted 465
4 SASI_Rn01_00141687 predicted 1074
5 SASI_Rn01_00141688 predicted 762
6 SASI_Rn01_00141689 predicted 1211
7 SASI_Rn01_00141690 predicted 977
8 SASI_Rn01_00141691 predicted 962
9 SASI_Rn01_00141692 predicted 854
10 SASI_Rn01_00141693 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110245 predicted 576
2 SASI_Mm02_00325131 predicted 1168
3 SASI_Mm02_00325132 predicted 1272
4 SASI_Mm02_00325133 predicted 1155
5 SASI_Mm01_00110246 predicted 398
6 SASI_Mm01_00110247 predicted 914
7 SASI_Mm01_00110249 predicted 995
8 SASI_Mm01_00110250 predicted 459
9 SASI_Mm01_00110252 predicted 802
10 SASI_Mm01_00110254 predicted 418
11 SASI_Mm01_00110248 predicted 296
12 SASI_Mm01_00110251 predicted 956
13 SASI_Mm01_00110253 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025211
GKAP1 MISSION shRNA Bacterial Glycerol Stock
G kinase anchoring protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-1526s21c1
Sequence:CCGGCAAGCAGAGTTAGCCAAATACCTCGAGGTATTTGGCTAACTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-1356s21c1
Sequence:CCGGAGGCAAGAAATGCACAATTATCTCGAGATAATTGTGCATTTCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-958s21c1
Sequence:CCGGTTCAACTCAGTCCAAAGTTATCTCGAGATAACTTTGGACTGAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-663s1c1
Sequence:CCGGGCTGTTTGTAACGCTCAACATCTCGAGATGTTGAGCGTTACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-1036s1c1
Sequence:CCGGGACTGGAAGATGATGTTCATACTCGAGTATGAACATCATCTTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-524s1c1
Sequence:CCGGGTCTCAAACTTTAGGAAGCAACTCGAGTTGCTTCCTAAAGTTTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-674s1c1
Sequence:CCGGCGCTCAACATGATCTTCCATTCTCGAGAATGGAAGATCATGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-1239s1c1
Sequence:CCGGGAGGCAAAGTATAAGGAAGTACTCGAGTACTTCCTTATACTTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025211
GKAP1 MISSION shRNA shRNA Plasmid DNA
G kinase anchoring protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-1526s21c1
Sequence:CCGGCAAGCAGAGTTAGCCAAATACCTCGAGGTATTTGGCTAACTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-1356s21c1
Sequence:CCGGAGGCAAGAAATGCACAATTATCTCGAGATAATTGTGCATTTCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-958s21c1
Sequence:CCGGTTCAACTCAGTCCAAAGTTATCTCGAGATAACTTTGGACTGAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-663s1c1
Sequence:CCGGGCTGTTTGTAACGCTCAACATCTCGAGATGTTGAGCGTTACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-1036s1c1
Sequence:CCGGGACTGGAAGATGATGTTCATACTCGAGTATGAACATCATCTTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-524s1c1
Sequence:CCGGGTCTCAAACTTTAGGAAGCAACTCGAGTTGCTTCCTAAAGTTTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-674s1c1
Sequence:CCGGCGCTCAACATGATCTTCCATTCTCGAGAATGGAAGATCATGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-1239s1c1
Sequence:CCGGGAGGCAAAGTATAAGGAAGTACTCGAGTACTTCCTTATACTTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025211
GKAP1 MISSION shRNA Lentiviral Transduction Particles
G kinase anchoring protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-1526s21c1
Sequence:CCGGCAAGCAGAGTTAGCCAAATACCTCGAGGTATTTGGCTAACTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-1356s21c1
Sequence:CCGGAGGCAAGAAATGCACAATTATCTCGAGATAATTGTGCATTTCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025211.3-958s21c1
Sequence:CCGGTTCAACTCAGTCCAAAGTTATCTCGAGATAACTTTGGACTGAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-663s1c1
Sequence:CCGGGCTGTTTGTAACGCTCAACATCTCGAGATGTTGAGCGTTACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-1036s1c1
Sequence:CCGGGACTGGAAGATGATGTTCATACTCGAGTATGAACATCATCTTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-524s1c1
Sequence:CCGGGTCTCAAACTTTAGGAAGCAACTCGAGTTGCTTCCTAAAGTTTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-674s1c1
Sequence:CCGGCGCTCAACATGATCTTCCATTCTCGAGAATGGAAGATCATGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025211.2-1239s1c1
Sequence:CCGGGAGGCAAAGTATAAGGAAGTACTCGAGTACTTCCTTATACTTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019832
VALIDATED
GKAP1 MISSION shRNA Bacterial Glycerol Stock
G kinase anchoring protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-571s21c1
Sequence:CCGGGCTGGAGTATGAAGAGCACAACTCGAGTTGTGCTCTTCATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-755s21c1
Sequence:CCGGGCTCAGACTTTATCACACGATCTCGAGATCGTGTGATAAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-955s21c1
Sequence:CCGGCGCAGAAATTCAGAAGCTCAACTCGAGTTGAGCTTCTGAATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-426s21c1
Sequence:CCGGGCAATGTTCAACATGAGCTTTCTCGAGAAAGCTCATGTTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-302s21c1
Sequence:CCGGGCAACCTCAAATGAGAAGAAACTCGAGTTTCTTCTCATTTGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-426s1c1
Sequence:CCGGGCAATGTTCAACATGAGCTTTCTCGAGAAAGCTCATGTTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-571s1c1
Sequence:CCGGGCTGGAGTATGAAGAGCACAACTCGAGTTGTGCTCTTCATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-755s1c1
Sequence:CCGGGCTCAGACTTTATCACACGATCTCGAGATCGTGTGATAAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-955s1c1
Sequence:CCGGCGCAGAAATTCAGAAGCTCAACTCGAGTTGAGCTTCTGAATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-302s1c1
Sequence:CCGGGCAACCTCAAATGAGAAGAAACTCGAGTTTCTTCTCATTTGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019832
VALIDATED
GKAP1 MISSION shRNA shRNA Plasmid DNA
G kinase anchoring protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-571s21c1
Sequence:CCGGGCTGGAGTATGAAGAGCACAACTCGAGTTGTGCTCTTCATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-755s21c1
Sequence:CCGGGCTCAGACTTTATCACACGATCTCGAGATCGTGTGATAAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-955s21c1
Sequence:CCGGCGCAGAAATTCAGAAGCTCAACTCGAGTTGAGCTTCTGAATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-426s21c1
Sequence:CCGGGCAATGTTCAACATGAGCTTTCTCGAGAAAGCTCATGTTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-302s21c1
Sequence:CCGGGCAACCTCAAATGAGAAGAAACTCGAGTTTCTTCTCATTTGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-426s1c1
Sequence:CCGGGCAATGTTCAACATGAGCTTTCTCGAGAAAGCTCATGTTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-571s1c1
Sequence:CCGGGCTGGAGTATGAAGAGCACAACTCGAGTTGTGCTCTTCATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-755s1c1
Sequence:CCGGGCTCAGACTTTATCACACGATCTCGAGATCGTGTGATAAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-955s1c1
Sequence:CCGGCGCAGAAATTCAGAAGCTCAACTCGAGTTGAGCTTCTGAATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-302s1c1
Sequence:CCGGGCAACCTCAAATGAGAAGAAACTCGAGTTTCTTCTCATTTGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019832
VALIDATED
GKAP1 MISSION shRNA Lentiviral Transduction Particles
G kinase anchoring protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-571s21c1
Sequence:CCGGGCTGGAGTATGAAGAGCACAACTCGAGTTGTGCTCTTCATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-755s21c1
Sequence:CCGGGCTCAGACTTTATCACACGATCTCGAGATCGTGTGATAAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-955s21c1
Sequence:CCGGCGCAGAAATTCAGAAGCTCAACTCGAGTTGAGCTTCTGAATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-426s21c1
Sequence:CCGGGCAATGTTCAACATGAGCTTTCTCGAGAAAGCTCATGTTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019832.3-302s21c1
Sequence:CCGGGCAACCTCAAATGAGAAGAAACTCGAGTTTCTTCTCATTTGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-426s1c1
Sequence:CCGGGCAATGTTCAACATGAGCTTTCTCGAGAAAGCTCATGTTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-571s1c1
Sequence:CCGGGCTGGAGTATGAAGAGCACAACTCGAGTTGTGCTCTTCATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-755s1c1
Sequence:CCGGGCTCAGACTTTATCACACGATCTCGAGATCGTGTGATAAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-955s1c1
Sequence:CCGGCGCAGAAATTCAGAAGCTCAACTCGAGTTGAGCTTCTGAATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019832.2-302s1c1
Sequence:CCGGGCAACCTCAAATGAGAAGAAACTCGAGTTTCTTCTCATTTGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks