EMAIL THIS PAGE TO A FRIEND

GKN1

gastrokine 1

64 Gene Product Result for
Synonyms: AMP18 BRICD1 CA11 FOV foveolin
UniProtKB ID: Q9NS71, Q8IUA9
Gene ID:
Human(56287) Summary: The protein encoded by this gene is found to be down-regulated in human gastric cancer tissue as compared to normal gastric mucosa. [provided by RefSeq, Jul 2008]
Mouse(66283) gastrokine 1
Rat(297418) gastrokine 1
chicken(769896) gastrokine 1
chicken(101668932) gastrokine 1
dog(612599) gastrokine 1
cow(407211) gastrokine 1
chicken(101748159) gastrokine 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019617 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022241 MISSION® esiRNA esiRNA human GKN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019617 Rosetta Predictions human pricing
NM_198972 Rosetta Predictions rat pricing
NM_025466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200273 predicted 492
2 SASI_Hs02_00352833 predicted 466
3 SASI_Hs01_00200274 predicted 518
4 SASI_Hs01_00200276 predicted 592
5 SASI_Hs01_00200277 predicted 316
6 SASI_Hs01_00200278 predicted 375
7 SASI_Hs01_00200279 predicted 359
8 SASI_Hs02_00352834 predicted 213
9 SASI_Hs01_00200280 predicted 460
10 SASI_Hs02_00352835 predicted 371
11 SASI_Hs01_00200275 predicted 226
12 SASI_Hs01_00200281 predicted 394
13 SASI_Hs01_00200282 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032975 predicted 212
2 SASI_Rn01_00032976 predicted 404
3 SASI_Rn02_00270072 predicted 380
4 SASI_Rn01_00032977 predicted 247
5 SASI_Rn01_00032978 predicted 372
6 SASI_Rn01_00032979 predicted 204
7 SASI_Rn01_00032980 predicted 401
8 SASI_Rn01_00032981 predicted 462
9 SASI_Rn01_00032982 predicted 462
10 SASI_Rn01_00032983 predicted 305
11 SASI_Rn01_00032984 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328321 predicted 704
2 SASI_Mm01_00118222 predicted 505
3 SASI_Mm01_00118223 predicted 584
4 SASI_Mm01_00118224 predicted 384
5 SASI_Mm01_00118225 predicted 728
6 SASI_Mm02_00328322 predicted 418
7 SASI_Mm01_00118226 predicted 550
8 SASI_Mm01_00118227 predicted 619
9 SASI_Mm01_00118229 predicted 466
10 SASI_Mm01_00118230 predicted 737
11 SASI_Mm01_00118228 predicted 573
12 SASI_Mm01_00118231 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019617
GKN1 MISSION shRNA Bacterial Glycerol Stock
gastrokine 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-458s1c1
Sequence:CCGGGCAAACATGTGTCGTGGGATTCTCGAGAATCCCACGACACATGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-92s1c1
Sequence:CCGGCCTGCCCTAGCTAACTATAATCTCGAGATTATAGTTAGCTAGGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-176s1c1
Sequence:CCGGGAACACAATGTGGCCAATGTTCTCGAGAACATTGGCCACATTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-115s1c1
Sequence:CCGGCAACGTCAATGATGACAACAACTCGAGTTGTTGTCATCATTGACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-118s1c1
Sequence:CCGGCGTCAATGATGACAACAACAACTCGAGTTGTTGTTGTCATCATTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-400s1c1
Sequence:CCGGGATGTACTCAGTCAACCCAAACTCGAGTTTGGGTTGACTGAGTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-410s1c1
Sequence:CCGGGTCAACCCAAACAAAGTCGATCTCGAGATCGACTTTGTTTGGGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-277s1c1
Sequence:CCGGGAAGACATGCATTGTGCACAACTCGAGTTGTGCACAATGCATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-403s1c1
Sequence:CCGGGTACTCAGTCAACCCAAACAACTCGAGTTGTTTGGGTTGACTGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019617
GKN1 MISSION shRNA shRNA Plasmid DNA
gastrokine 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-458s1c1
Sequence:CCGGGCAAACATGTGTCGTGGGATTCTCGAGAATCCCACGACACATGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-92s1c1
Sequence:CCGGCCTGCCCTAGCTAACTATAATCTCGAGATTATAGTTAGCTAGGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-176s1c1
Sequence:CCGGGAACACAATGTGGCCAATGTTCTCGAGAACATTGGCCACATTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-115s1c1
Sequence:CCGGCAACGTCAATGATGACAACAACTCGAGTTGTTGTCATCATTGACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-118s1c1
Sequence:CCGGCGTCAATGATGACAACAACAACTCGAGTTGTTGTTGTCATCATTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-400s1c1
Sequence:CCGGGATGTACTCAGTCAACCCAAACTCGAGTTTGGGTTGACTGAGTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-410s1c1
Sequence:CCGGGTCAACCCAAACAAAGTCGATCTCGAGATCGACTTTGTTTGGGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-277s1c1
Sequence:CCGGGAAGACATGCATTGTGCACAACTCGAGTTGTGCACAATGCATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-403s1c1
Sequence:CCGGGTACTCAGTCAACCCAAACAACTCGAGTTGTTTGGGTTGACTGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019617
GKN1 MISSION shRNA Lentiviral Transduction Particles
gastrokine 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-458s1c1
Sequence:CCGGGCAAACATGTGTCGTGGGATTCTCGAGAATCCCACGACACATGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-92s1c1
Sequence:CCGGCCTGCCCTAGCTAACTATAATCTCGAGATTATAGTTAGCTAGGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-176s1c1
Sequence:CCGGGAACACAATGTGGCCAATGTTCTCGAGAACATTGGCCACATTGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-115s1c1
Sequence:CCGGCAACGTCAATGATGACAACAACTCGAGTTGTTGTCATCATTGACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019617.2-118s1c1
Sequence:CCGGCGTCAATGATGACAACAACAACTCGAGTTGTTGTTGTCATCATTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-400s1c1
Sequence:CCGGGATGTACTCAGTCAACCCAAACTCGAGTTTGGGTTGACTGAGTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-410s1c1
Sequence:CCGGGTCAACCCAAACAAAGTCGATCTCGAGATCGACTTTGTTTGGGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-277s1c1
Sequence:CCGGGAAGACATGCATTGTGCACAACTCGAGTTGTGCACAATGCATGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019617.2-403s1c1
Sequence:CCGGGTACTCAGTCAACCCAAACAACTCGAGTTGTTTGGGTTGACTGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025466
GKN1 MISSION shRNA Bacterial Glycerol Stock
gastrokine 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025466.1-184s1c1
Sequence:CCGGCGTGGCCAATATCGACAACAACTCGAGTTGTTGTCGATATTGGCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-107s21c1
Sequence:CCGGACGGTCAACATCAATGGTAATCTCGAGATTACCATTGATGTTGACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025466.1-780s21c1
Sequence:CCGGTCAGGACCTCTCCGCTATAAACTCGAGTTTATAGCGGAGAGGTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025466.1-628s1c1
Sequence:CCGGGACCATCGCAATGCTTGATTACTCGAGTAATCAAGCATTGCGATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-345s21c1
Sequence:CCGGTCAAGGAACAGAAGGGTAAAGCTCGAGCTTTACCCTTCTGTTCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-323s21c1
Sequence:CCGGCTTCAGGACCTCGATACAATGCTCGAGCATTGTATCGAGGTCCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025466
GKN1 MISSION shRNA shRNA Plasmid DNA
gastrokine 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025466.1-184s1c1
Sequence:CCGGCGTGGCCAATATCGACAACAACTCGAGTTGTTGTCGATATTGGCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-107s21c1
Sequence:CCGGACGGTCAACATCAATGGTAATCTCGAGATTACCATTGATGTTGACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025466.1-780s21c1
Sequence:CCGGTCAGGACCTCTCCGCTATAAACTCGAGTTTATAGCGGAGAGGTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025466.1-628s1c1
Sequence:CCGGGACCATCGCAATGCTTGATTACTCGAGTAATCAAGCATTGCGATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-345s21c1
Sequence:CCGGTCAAGGAACAGAAGGGTAAAGCTCGAGCTTTACCCTTCTGTTCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-323s21c1
Sequence:CCGGCTTCAGGACCTCGATACAATGCTCGAGCATTGTATCGAGGTCCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025466
GKN1 MISSION shRNA Lentiviral Transduction Particles
gastrokine 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025466.1-184s1c1
Sequence:CCGGCGTGGCCAATATCGACAACAACTCGAGTTGTTGTCGATATTGGCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-107s21c1
Sequence:CCGGACGGTCAACATCAATGGTAATCTCGAGATTACCATTGATGTTGACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025466.1-780s21c1
Sequence:CCGGTCAGGACCTCTCCGCTATAAACTCGAGTTTATAGCGGAGAGGTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025466.1-628s1c1
Sequence:CCGGGACCATCGCAATGCTTGATTACTCGAGTAATCAAGCATTGCGATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-345s21c1
Sequence:CCGGTCAAGGAACAGAAGGGTAAAGCTCGAGCTTTACCCTTCTGTTCCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025466.1-323s21c1
Sequence:CCGGCTTCAGGACCTCGATACAATGCTCGAGCATTGTATCGAGGTCCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)