EMAIL THIS PAGE TO A FRIEND

GKN2

gastrokine 2

70 Gene Product Result for
Synonyms: BRICD1B GDDR PRO813 TFIZ1 VLTI465
UniProtKB ID: Q86XP6, Q6UWS6
Gene ID:
Mouse(66284) gastrokine 2
Rat(297419) gastrokine 2
chicken(419515) gastrokine 2
dog(612594) gastrokine 2
cow(512001) gastrokine 2
sheep(101108640) gastrokine 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182536 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027721 MISSION® esiRNA esiRNA human GKN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182536 Rosetta Predictions human pricing
NM_001039686 Rosetta Predictions rat pricing
NM_025467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018745 predicted 297
2 SASI_Hs01_00018746 predicted 533
3 SASI_Hs01_00018747 predicted 273
4 SASI_Hs01_00018748 predicted 469
5 SASI_Hs01_00018750 predicted 442
6 SASI_Hs02_00370641 predicted 532
7 SASI_Hs01_00018752 predicted 514
8 SASI_Hs02_00370642 predicted 215
9 SASI_Hs02_00370643 predicted 276
10 SASI_Hs01_00018754 predicted 512
11 SASI_Hs01_00018749 predicted 400
12 SASI_Hs01_00018751 predicted 528
13 SASI_Hs01_00018753 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062542 predicted 221
2 SASI_Rn01_00062543 predicted 370
3 SASI_Rn01_00062544 predicted 441
4 SASI_Rn01_00062545 predicted 266
5 SASI_Rn01_00062546 predicted 362
6 SASI_Rn01_00062547 predicted 314
7 SASI_Rn01_00062548 predicted 345
8 SASI_Rn01_00062549 predicted 327
9 SASI_Rn01_00062550 predicted 319
10 SASI_Rn01_00062551 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057137 predicted 296
2 SASI_Mm01_00057138 predicted 368
3 SASI_Mm01_00057139 predicted 269
4 SASI_Mm01_00057140 predicted 516
5 SASI_Mm01_00057141 predicted 435
6 SASI_Mm01_00057142 predicted 223
7 SASI_Mm01_00057143 predicted 315
8 SASI_Mm01_00057144 predicted 504
9 SASI_Mm02_00328323 predicted 299
10 SASI_Mm01_00057146 predicted 264
11 SASI_Mm01_00057145 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025467
GKN2 MISSION shRNA Bacterial Glycerol Stock
gastrokine 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-278s1c1
Sequence:CCGGGTCATCAAGATGGACCACAAACTCGAGTTTGTGGTCCATCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-316s1c1
Sequence:CCGGCAAACTCCAACGGTTCCTCTACTCGAGTAGAGGAACCGTTGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-265s1c1
Sequence:CCGGGAGAGCCTGTTACGTCATCAACTCGAGTTGATGACGTAACAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-334s1c1
Sequence:CCGGCTACGAGAAGCAGACAATGAACTCGAGTTCATTGTCTGCTTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025467.1-593s1c1
Sequence:CCGGCCATCAACTGGCTTCATCTTTCTCGAGAAAGATGAAGCCAGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025467
GKN2 MISSION shRNA shRNA Plasmid DNA
gastrokine 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-278s1c1
Sequence:CCGGGTCATCAAGATGGACCACAAACTCGAGTTTGTGGTCCATCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-316s1c1
Sequence:CCGGCAAACTCCAACGGTTCCTCTACTCGAGTAGAGGAACCGTTGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-265s1c1
Sequence:CCGGGAGAGCCTGTTACGTCATCAACTCGAGTTGATGACGTAACAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-334s1c1
Sequence:CCGGCTACGAGAAGCAGACAATGAACTCGAGTTCATTGTCTGCTTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025467.1-593s1c1
Sequence:CCGGCCATCAACTGGCTTCATCTTTCTCGAGAAAGATGAAGCCAGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025467
GKN2 MISSION shRNA Lentiviral Transduction Particles
gastrokine 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-278s1c1
Sequence:CCGGGTCATCAAGATGGACCACAAACTCGAGTTTGTGGTCCATCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-316s1c1
Sequence:CCGGCAAACTCCAACGGTTCCTCTACTCGAGTAGAGGAACCGTTGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-265s1c1
Sequence:CCGGGAGAGCCTGTTACGTCATCAACTCGAGTTGATGACGTAACAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025467.1-334s1c1
Sequence:CCGGCTACGAGAAGCAGACAATGAACTCGAGTTCATTGTCTGCTTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025467.1-593s1c1
Sequence:CCGGCCATCAACTGGCTTCATCTTTCTCGAGAAAGATGAAGCCAGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182536
GKN2 MISSION shRNA Bacterial Glycerol Stock
gastrokine 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-324s1c1
Sequence:CCGGCCAATGGTACATCTATGAGAACTCGAGTTCTCATAGATGTACCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-82s1c1
Sequence:CCGGCAATCTCATGGATACGAGGTTCTCGAGAACCTCGTATCCATGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-548s1c1
Sequence:CCGGGCATCTTGGGAATTTCAATCTCTCGAGAGATTGAAATTCCCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-445s1c1
Sequence:CCGGCCCATTGAGAAACTCTGCAAACTCGAGTTTGCAGAGTTTCTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-64s1c1
Sequence:CCGGCTGACCATCTTTGGGATACAACTCGAGTTGTATCCCAAAGATGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-369s1c1
Sequence:CCGGCAGCAAATACACCTGGGTCAACTCGAGTTGACCCAGGTGTATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-78s1c1
Sequence:CCGGGATACAATCTCATGGATACGACTCGAGTCGTATCCATGAGATTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-411s1c1
Sequence:CCGGGATCAAAGACGTGGATTGGTTCTCGAGAACCAATCCACGTCTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-372s1c1
Sequence:CCGGCAAATACACCTGGGTCAAGTACTCGAGTACTTGACCCAGGTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182536
GKN2 MISSION shRNA shRNA Plasmid DNA
gastrokine 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-324s1c1
Sequence:CCGGCCAATGGTACATCTATGAGAACTCGAGTTCTCATAGATGTACCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-82s1c1
Sequence:CCGGCAATCTCATGGATACGAGGTTCTCGAGAACCTCGTATCCATGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-548s1c1
Sequence:CCGGGCATCTTGGGAATTTCAATCTCTCGAGAGATTGAAATTCCCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-445s1c1
Sequence:CCGGCCCATTGAGAAACTCTGCAAACTCGAGTTTGCAGAGTTTCTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-64s1c1
Sequence:CCGGCTGACCATCTTTGGGATACAACTCGAGTTGTATCCCAAAGATGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-369s1c1
Sequence:CCGGCAGCAAATACACCTGGGTCAACTCGAGTTGACCCAGGTGTATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-78s1c1
Sequence:CCGGGATACAATCTCATGGATACGACTCGAGTCGTATCCATGAGATTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-411s1c1
Sequence:CCGGGATCAAAGACGTGGATTGGTTCTCGAGAACCAATCCACGTCTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-372s1c1
Sequence:CCGGCAAATACACCTGGGTCAAGTACTCGAGTACTTGACCCAGGTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182536
GKN2 MISSION shRNA Lentiviral Transduction Particles
gastrokine 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-324s1c1
Sequence:CCGGCCAATGGTACATCTATGAGAACTCGAGTTCTCATAGATGTACCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-82s1c1
Sequence:CCGGCAATCTCATGGATACGAGGTTCTCGAGAACCTCGTATCCATGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-548s1c1
Sequence:CCGGGCATCTTGGGAATTTCAATCTCTCGAGAGATTGAAATTCCCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-445s1c1
Sequence:CCGGCCCATTGAGAAACTCTGCAAACTCGAGTTTGCAGAGTTTCTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-64s1c1
Sequence:CCGGCTGACCATCTTTGGGATACAACTCGAGTTGTATCCCAAAGATGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-369s1c1
Sequence:CCGGCAGCAAATACACCTGGGTCAACTCGAGTTGACCCAGGTGTATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-78s1c1
Sequence:CCGGGATACAATCTCATGGATACGACTCGAGTCGTATCCATGAGATTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182536.1-411s1c1
Sequence:CCGGGATCAAAGACGTGGATTGGTTCTCGAGAACCAATCCACGTCTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182536.1-372s1c1
Sequence:CCGGCAAATACACCTGGGTCAAGTACTCGAGTACTTGACCCAGGTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks