EMAIL THIS PAGE TO A FRIEND

GLA

galactosidase, alpha

52 Gene Product Result for
Synonyms: GALA
UniProtKB ID: P06280
Gene ID:
Human(2717) Summary: This gene encodes a homodimeric glycoprotein that hydrolyses the terminal alpha-galactosyl moieties from glycolipids and glycoproteins. This enzyme predominantly hydrolyzes ceramide trihexoside, and it can catalyze the hydrolysis of melibiose into galactose and glucose. A variety of mutations in this gene affect the synthesis, processing, and stability of this enzyme, which causes Fabry disease, a rare lysosomal storage disorder that results from a failure to catabolize alpha-D-galactosyl glycolipid moieties. [provided by RefSeq, Jul 2008]
Mouse(11605) galactosidase, alpha
Rat(363494) galactosidase, alpha
Zebrafish(450083) galactosidase, alpha
dog(480988) galactosidase, alpha
cow(532742) galactosidase, alpha
Horse(100060370) galactosidase, alpha
domestic cat(101091428) galactosidase, alpha
chicken(422188) galactosidase, alpha
domestic guinea pig(100718405) galactosidase, alpha
naked mole-rat(101713601) galactosidase, alpha
Goat(100861188) galactosidase, alpha
sheep(101106236) galactosidase, alpha
Domestic Rabbit(100344610) galactosidase, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056601 MISSION® esiRNA esiRNA human GLA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000169 Rosetta Predictions human pricing
NM_001108820 Rosetta Predictions rat pricing
NM_013463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161395 predicted 776
2 SASI_Hs01_00161397 predicted 1089
3 SASI_Hs01_00161398 predicted 967
4 SASI_Hs01_00161399 predicted 892
5 SASI_Hs01_00161400 predicted 613
6 SASI_Hs01_00161402 predicted 901
7 SASI_Hs02_00302000 predicted 360
8 SASI_Hs01_00161403 predicted 1174
9 SASI_Hs02_00302001 predicted 858
10 SASI_Hs02_00302002 predicted 657
11 SASI_Hs01_00161396 predicted 921
12 SASI_Hs01_00161401 predicted 711
13 SASI_Hs01_00161404 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242395 predicted 676
2 SASI_Rn02_00242396 predicted 917
3 SASI_Rn02_00242397 predicted 932
4 SASI_Rn02_00242398 predicted 1204
5 SASI_Rn02_00242399 predicted 821
6 SASI_Rn02_00242400 predicted 1274
7 SASI_Rn02_00242401 predicted 668
8 SASI_Rn02_00242402 predicted 1098
9 SASI_Rn02_00242403 predicted 686
10 SASI_Rn02_00242404 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322070 predicted 717
2 SASI_Mm02_00322071 predicted 865
3 SASI_Mm02_00322072 predicted 700
4 SASI_Mm02_00322073 predicted 694
5 SASI_Mm02_00322074 predicted 724
6 SASI_Mm02_00322075 predicted 1048
7 SASI_Mm02_00322076 predicted 450
8 SASI_Mm02_00322077 predicted 406
9 SASI_Mm02_00322078 predicted 686
10 SASI_Mm02_00322079 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000169
VALIDATED
GLA MISSION shRNA Bacterial Glycerol Stock
galactosidase, alpha
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-667s21c1
Sequence:GTACCGGACATGTCCTTGGCCCTGAATACTCGAGTATTCAGGGCCAAGGACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-621s21c1
Sequence:GTACCGGGGTTGTTACTGTGACAGTTTGCTCGAGCAAACTGTCACAGTAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-1197s21c1
Sequence:CCGGCGCTCTTATACCATCGCAGTTCTCGAGAACTGCGATGGTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-983s21c1
Sequence:CCGGTGCTCCTTTATTCATGTCTAACTCGAGTTAGACATGAATAAAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-492s21c1
Sequence:CCGGGGACTGAAGCTAGGGATTTATCTCGAGATAAATCCCTAGCTTCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-458s21c1
Sequence:CCGGGATTCGCCAGCTAGCTAATTACTCGAGTAATTAGCTAGCTGGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-776s21c1
Sequence:CCGGCTGCAATCACTGGCGAAATTTCTCGAGAAATTTCGCCAGTGATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-910s21c1
Sequence:GTACCGGTGTTAGTGATTGGCAACTTTGCTCGAGCAAAGTTGCCAATCACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-349s21c1
Sequence:GTACCGGGCTGGAAGGATGCAGGTTATGCTCGAGCATAACCTGCATCCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-673s1c1
Sequence:CCGGCCTCTTTATATGTGGCCCTTTCTCGAGAAAGGGCCACATATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-933s1c1
Sequence:CCGGTGCTCCTTTATTCATGTCTAACTCGAGTTAGACATGAATAAAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-990s1c1
Sequence:CCGGCCTTCAGGATAAGGACGTAATCTCGAGATTACGTCCTTATCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-1147s1c1
Sequence:CCGGCGCTCTTATACCATCGCAGTTCTCGAGAACTGCGATGGTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-934s1c1
Sequence:CCGGGCTCCTTTATTCATGTCTAATCTCGAGATTAGACATGAATAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000169
VALIDATED
GLA MISSION shRNA shRNA Plasmid DNA
galactosidase, alpha
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-667s21c1
Sequence:GTACCGGACATGTCCTTGGCCCTGAATACTCGAGTATTCAGGGCCAAGGACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-621s21c1
Sequence:GTACCGGGGTTGTTACTGTGACAGTTTGCTCGAGCAAACTGTCACAGTAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-1197s21c1
Sequence:CCGGCGCTCTTATACCATCGCAGTTCTCGAGAACTGCGATGGTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-983s21c1
Sequence:CCGGTGCTCCTTTATTCATGTCTAACTCGAGTTAGACATGAATAAAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-492s21c1
Sequence:CCGGGGACTGAAGCTAGGGATTTATCTCGAGATAAATCCCTAGCTTCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-458s21c1
Sequence:CCGGGATTCGCCAGCTAGCTAATTACTCGAGTAATTAGCTAGCTGGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-776s21c1
Sequence:CCGGCTGCAATCACTGGCGAAATTTCTCGAGAAATTTCGCCAGTGATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-910s21c1
Sequence:GTACCGGTGTTAGTGATTGGCAACTTTGCTCGAGCAAAGTTGCCAATCACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-349s21c1
Sequence:GTACCGGGCTGGAAGGATGCAGGTTATGCTCGAGCATAACCTGCATCCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-673s1c1
Sequence:CCGGCCTCTTTATATGTGGCCCTTTCTCGAGAAAGGGCCACATATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-933s1c1
Sequence:CCGGTGCTCCTTTATTCATGTCTAACTCGAGTTAGACATGAATAAAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-990s1c1
Sequence:CCGGCCTTCAGGATAAGGACGTAATCTCGAGATTACGTCCTTATCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-1147s1c1
Sequence:CCGGCGCTCTTATACCATCGCAGTTCTCGAGAACTGCGATGGTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-934s1c1
Sequence:CCGGGCTCCTTTATTCATGTCTAATCTCGAGATTAGACATGAATAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000169
VALIDATED
GLA MISSION shRNA Lentiviral Transduction Particles
galactosidase, alpha
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-667s21c1
Sequence:GTACCGGACATGTCCTTGGCCCTGAATACTCGAGTATTCAGGGCCAAGGACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-621s21c1
Sequence:GTACCGGGGTTGTTACTGTGACAGTTTGCTCGAGCAAACTGTCACAGTAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-1197s21c1
Sequence:CCGGCGCTCTTATACCATCGCAGTTCTCGAGAACTGCGATGGTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-983s21c1
Sequence:CCGGTGCTCCTTTATTCATGTCTAACTCGAGTTAGACATGAATAAAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-492s21c1
Sequence:CCGGGGACTGAAGCTAGGGATTTATCTCGAGATAAATCCCTAGCTTCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-458s21c1
Sequence:CCGGGATTCGCCAGCTAGCTAATTACTCGAGTAATTAGCTAGCTGGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000169.2-776s21c1
Sequence:CCGGCTGCAATCACTGGCGAAATTTCTCGAGAAATTTCGCCAGTGATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-910s21c1
Sequence:GTACCGGTGTTAGTGATTGGCAACTTTGCTCGAGCAAAGTTGCCAATCACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000169.2-349s21c1
Sequence:GTACCGGGCTGGAAGGATGCAGGTTATGCTCGAGCATAACCTGCATCCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-673s1c1
Sequence:CCGGCCTCTTTATATGTGGCCCTTTCTCGAGAAAGGGCCACATATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-933s1c1
Sequence:CCGGTGCTCCTTTATTCATGTCTAACTCGAGTTAGACATGAATAAAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-990s1c1
Sequence:CCGGCCTTCAGGATAAGGACGTAATCTCGAGATTACGTCCTTATCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-1147s1c1
Sequence:CCGGCGCTCTTATACCATCGCAGTTCTCGAGAACTGCGATGGTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000169.1-934s1c1
Sequence:CCGGGCTCCTTTATTCATGTCTAATCTCGAGATTAGACATGAATAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013463
VALIDATED
GLA MISSION shRNA Bacterial Glycerol Stock
galactosidase, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013463.1-385s1c1
Sequence:CCGGGCAAATTACGTCCACAGCAAACTCGAGTTTGCTGTGGACGTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-949s1c1
Sequence:CCGGGCTCTGCTTCAGAATAAGGATCTCGAGATCCTTATTCTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-637s1c1
Sequence:CCGGCCACTTTATTTGAGACCCTTTCTCGAGAAAGGGTCTCAAATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013463.1-1297s1c1
Sequence:CCGGGCAGAGTTCTATGTCCCGTTTCTCGAGAAACGGGACATAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-653s1c1
Sequence:CCGGCCTTTCATAAGCCCAATTATACTCGAGTATAATTGGGCTTATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013463
VALIDATED
GLA MISSION shRNA shRNA Plasmid DNA
galactosidase, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013463.1-385s1c1
Sequence:CCGGGCAAATTACGTCCACAGCAAACTCGAGTTTGCTGTGGACGTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-949s1c1
Sequence:CCGGGCTCTGCTTCAGAATAAGGATCTCGAGATCCTTATTCTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-637s1c1
Sequence:CCGGCCACTTTATTTGAGACCCTTTCTCGAGAAAGGGTCTCAAATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013463.1-1297s1c1
Sequence:CCGGGCAGAGTTCTATGTCCCGTTTCTCGAGAAACGGGACATAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-653s1c1
Sequence:CCGGCCTTTCATAAGCCCAATTATACTCGAGTATAATTGGGCTTATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013463
VALIDATED
GLA MISSION shRNA Lentiviral Transduction Particles
galactosidase, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013463.1-385s1c1
Sequence:CCGGGCAAATTACGTCCACAGCAAACTCGAGTTTGCTGTGGACGTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-949s1c1
Sequence:CCGGGCTCTGCTTCAGAATAAGGATCTCGAGATCCTTATTCTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-637s1c1
Sequence:CCGGCCACTTTATTTGAGACCCTTTCTCGAGAAAGGGTCTCAAATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013463.1-1297s1c1
Sequence:CCGGGCAGAGTTCTATGTCCCGTTTCTCGAGAAACGGGACATAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013463.1-653s1c1
Sequence:CCGGCCTTTCATAAGCCCAATTATACTCGAGTATAATTGGGCTTATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks