EMAIL THIS PAGE TO A FRIEND

GLB1L2

galactosidase, beta 1-like 2

60 Gene Product Result for
Synonyms: MST114 MSTP114
Gene ID:
Mouse(244757) galactosidase, beta 1-like 2
Rat(503194) galactosidase, beta 1-like 2
chicken(428238) galactosidase, beta 1-like 2
cow(519145) galactosidase, beta 1-like 2
Horse(100072910) galactosidase, beta 1-like 2
dog(606786) galactosidase, beta 1-like 2
naked mole-rat(101710289) galactosidase, beta 1-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138342 Rosetta Predictions human pricing
XM_001053731 Rosetta Predictions rat pricing
XM_578717 Rosetta Predictions rat pricing
NM_153803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162607 predicted 1297
2 SASI_Hs01_00162608 predicted 2000
3 SASI_Hs01_00162609 predicted 1173
4 SASI_Hs02_00363431 predicted 1793
5 SASI_Hs01_00162610 predicted 521
6 SASI_Hs01_00162611 predicted 1012
7 SASI_Hs01_00162613 predicted 1521
8 SASI_Hs01_00162614 predicted 873
9 SASI_Hs01_00162615 predicted 1151
10 SASI_Hs01_00162616 predicted 1655
11 SASI_Hs01_00162612 predicted 1782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273396 predicted 1040
2 SASI_Rn02_00273397 predicted 273
3 SASI_Rn02_00273398 predicted 801
4 SASI_Rn02_00273399 predicted 802
5 SASI_Rn02_00273400 predicted 1840
6 SASI_Rn02_00273401 predicted 1108
7 SASI_Rn02_00273402 predicted 1653
8 SASI_Rn02_00273403 predicted 1493
9 SASI_Rn02_00273404 predicted 1585
10 SASI_Rn02_00273405 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408256 predicted 1984
2 SASI_Rn02_00408257 predicted 2025
3 SASI_Rn02_00408258 predicted 2105
4 SASI_Rn02_00408259 predicted 2090
5 SASI_Rn02_00408260 predicted 2018
6 SASI_Rn02_00408261 predicted 2081
7 SASI_Rn02_00408262 predicted 2180
8 SASI_Rn02_00408263 predicted 2079
9 SASI_Rn02_00408264 predicted 2103
10 SASI_Rn02_00408265 predicted 2192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103075 predicted 2075
2 SASI_Mm02_00343540 predicted 712
3 SASI_Mm01_00103076 predicted 393
4 SASI_Mm01_00103077 predicted 1271
5 SASI_Mm01_00103078 predicted 1565
6 SASI_Mm01_00103079 predicted 1222
7 SASI_Mm01_00103080 predicted 1578
8 SASI_Mm02_00343541 predicted 955
9 SASI_Mm01_00103081 predicted 750
10 SASI_Mm01_00103082 predicted 1141
11 SASI_Mm01_00103074 predicted 991
12 SASI_Mm01_00103083 predicted 1097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138342
VALIDATED
GLB1L2 MISSION shRNA Bacterial Glycerol Stock
galactosidase, beta 1-like 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-653s1c1
Sequence:CCGGCCGAAGCAGTGGACCTTTATTCTCGAGAATAAAGGTCCACTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-2005s1c1
Sequence:CCGGCCTGCATTACAGTTCACGGAACTCGAGTTCCGTGAACTGTAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138342.2-2544s1c1
Sequence:CCGGGAGCTGACTTTGTTCTTCCTTCTCGAGAAGGAAGAACAAAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138342.2-2549s1c1
Sequence:CCGGGACTTTGTTCTTCCTTCACAACTCGAGTTGTGAAGGAAGAACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-1784s1c1
Sequence:CCGGCCACATTACCTGCTTTCTTCTCTCGAGAGAAGAAAGCAGGTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.2-2567s21c1
Sequence:CCGGCAACCTTCTGAGCCTTCTTTGCTCGAGCAAAGAAGGCTCAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-2573s21c1
Sequence:CCGGGTCTCACCTGAGCTGACTTTGCTCGAGCAAAGTCAGCTCAGGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-689s21c1
Sequence:CCGGCACCGAAGCAGTGGACCTTTACTCGAGTAAAGGTCCACTGCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1684s21c1
Sequence:CCGGACCAGCGCAAAGGCTTAATTGCTCGAGCAATTAAGCCTTTGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1648s21c1
Sequence:CCGGATCGTGGGCGAGTCAACTATGCTCGAGCATAGTTGACTCGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.2-1541s21c1
Sequence:CCGGACTACAAGACAACGAAGATTGCTCGAGCAATCTTCGTTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1468s21c1
Sequence:CCGGCCTTCGGGTACATTCTCTATGCTCGAGCATAGAGAATGTACCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138342.3-1334s21c1
Sequence:CCGGGATGCCGTATGAGCCCTTAACCTCGAGGTTAAGGGCTCATACGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138342
VALIDATED
GLB1L2 MISSION shRNA shRNA Plasmid DNA
galactosidase, beta 1-like 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-653s1c1
Sequence:CCGGCCGAAGCAGTGGACCTTTATTCTCGAGAATAAAGGTCCACTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-2005s1c1
Sequence:CCGGCCTGCATTACAGTTCACGGAACTCGAGTTCCGTGAACTGTAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138342.2-2544s1c1
Sequence:CCGGGAGCTGACTTTGTTCTTCCTTCTCGAGAAGGAAGAACAAAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138342.2-2549s1c1
Sequence:CCGGGACTTTGTTCTTCCTTCACAACTCGAGTTGTGAAGGAAGAACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-1784s1c1
Sequence:CCGGCCACATTACCTGCTTTCTTCTCTCGAGAGAAGAAAGCAGGTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.2-2567s21c1
Sequence:CCGGCAACCTTCTGAGCCTTCTTTGCTCGAGCAAAGAAGGCTCAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-2573s21c1
Sequence:CCGGGTCTCACCTGAGCTGACTTTGCTCGAGCAAAGTCAGCTCAGGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-689s21c1
Sequence:CCGGCACCGAAGCAGTGGACCTTTACTCGAGTAAAGGTCCACTGCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1684s21c1
Sequence:CCGGACCAGCGCAAAGGCTTAATTGCTCGAGCAATTAAGCCTTTGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1648s21c1
Sequence:CCGGATCGTGGGCGAGTCAACTATGCTCGAGCATAGTTGACTCGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.2-1541s21c1
Sequence:CCGGACTACAAGACAACGAAGATTGCTCGAGCAATCTTCGTTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1468s21c1
Sequence:CCGGCCTTCGGGTACATTCTCTATGCTCGAGCATAGAGAATGTACCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138342.3-1334s21c1
Sequence:CCGGGATGCCGTATGAGCCCTTAACCTCGAGGTTAAGGGCTCATACGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138342
VALIDATED
GLB1L2 MISSION shRNA Lentiviral Transduction Particles
galactosidase, beta 1-like 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-653s1c1
Sequence:CCGGCCGAAGCAGTGGACCTTTATTCTCGAGAATAAAGGTCCACTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-2005s1c1
Sequence:CCGGCCTGCATTACAGTTCACGGAACTCGAGTTCCGTGAACTGTAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138342.2-2544s1c1
Sequence:CCGGGAGCTGACTTTGTTCTTCCTTCTCGAGAAGGAAGAACAAAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138342.2-2549s1c1
Sequence:CCGGGACTTTGTTCTTCCTTCACAACTCGAGTTGTGAAGGAAGAACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138342.2-1784s1c1
Sequence:CCGGCCACATTACCTGCTTTCTTCTCTCGAGAGAAGAAAGCAGGTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.2-2567s21c1
Sequence:CCGGCAACCTTCTGAGCCTTCTTTGCTCGAGCAAAGAAGGCTCAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-2573s21c1
Sequence:CCGGGTCTCACCTGAGCTGACTTTGCTCGAGCAAAGTCAGCTCAGGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-689s21c1
Sequence:CCGGCACCGAAGCAGTGGACCTTTACTCGAGTAAAGGTCCACTGCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1684s21c1
Sequence:CCGGACCAGCGCAAAGGCTTAATTGCTCGAGCAATTAAGCCTTTGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1648s21c1
Sequence:CCGGATCGTGGGCGAGTCAACTATGCTCGAGCATAGTTGACTCGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.2-1541s21c1
Sequence:CCGGACTACAAGACAACGAAGATTGCTCGAGCAATCTTCGTTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138342.3-1468s21c1
Sequence:CCGGCCTTCGGGTACATTCTCTATGCTCGAGCATAGAGAATGTACCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138342.3-1334s21c1
Sequence:CCGGGATGCCGTATGAGCCCTTAACCTCGAGGTTAAGGGCTCATACGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153803
GLB1L2 MISSION shRNA Bacterial Glycerol Stock
galactosidase, beta 1-like 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-3194s1c1
Sequence:CCGGCCAGAACATATCATTGAGCTACTCGAGTAGCTCAATGATATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153803.1-1901s1c1
Sequence:CCGGCAAAGGAATCAACAAGGTTATCTCGAGATAACCTTGTTGATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153803.1-1592s1c1
Sequence:CCGGGCGCAAAGGTTTAATTGGAAACTCGAGTTTCCAATTAAACCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-2631s1c1
Sequence:CCGGCCATGTTAAGAGGTTGGCATTCTCGAGAATGCCAACCTCTTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-3156s1c1
Sequence:CCGGGCTGGTAGTTAAGAATAAGAACTCGAGTTCTTATTCTTAACTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-854s21c1
Sequence:CCGGACAGGAGCTGATGGCACTAAACTCGAGTTTAGTGCCATCAGCTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-1470s21c1
Sequence:CCGGATAGGATTCCTGGACTATAAACTCGAGTTTATAGTCCAGGAATCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-1105s21c1
Sequence:CCGGATGTTACCAGCTATGACTATGCTCGAGCATAGTCATAGCTGGTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153803
GLB1L2 MISSION shRNA shRNA Plasmid DNA
galactosidase, beta 1-like 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-3194s1c1
Sequence:CCGGCCAGAACATATCATTGAGCTACTCGAGTAGCTCAATGATATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153803.1-1901s1c1
Sequence:CCGGCAAAGGAATCAACAAGGTTATCTCGAGATAACCTTGTTGATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153803.1-1592s1c1
Sequence:CCGGGCGCAAAGGTTTAATTGGAAACTCGAGTTTCCAATTAAACCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-2631s1c1
Sequence:CCGGCCATGTTAAGAGGTTGGCATTCTCGAGAATGCCAACCTCTTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-3156s1c1
Sequence:CCGGGCTGGTAGTTAAGAATAAGAACTCGAGTTCTTATTCTTAACTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-854s21c1
Sequence:CCGGACAGGAGCTGATGGCACTAAACTCGAGTTTAGTGCCATCAGCTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-1470s21c1
Sequence:CCGGATAGGATTCCTGGACTATAAACTCGAGTTTATAGTCCAGGAATCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-1105s21c1
Sequence:CCGGATGTTACCAGCTATGACTATGCTCGAGCATAGTCATAGCTGGTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153803
GLB1L2 MISSION shRNA Lentiviral Transduction Particles
galactosidase, beta 1-like 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-3194s1c1
Sequence:CCGGCCAGAACATATCATTGAGCTACTCGAGTAGCTCAATGATATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153803.1-1901s1c1
Sequence:CCGGCAAAGGAATCAACAAGGTTATCTCGAGATAACCTTGTTGATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153803.1-1592s1c1
Sequence:CCGGGCGCAAAGGTTTAATTGGAAACTCGAGTTTCCAATTAAACCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-2631s1c1
Sequence:CCGGCCATGTTAAGAGGTTGGCATTCTCGAGAATGCCAACCTCTTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153803.1-3156s1c1
Sequence:CCGGGCTGGTAGTTAAGAATAAGAACTCGAGTTCTTATTCTTAACTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-854s21c1
Sequence:CCGGACAGGAGCTGATGGCACTAAACTCGAGTTTAGTGCCATCAGCTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-1470s21c1
Sequence:CCGGATAGGATTCCTGGACTATAAACTCGAGTTTATAGTCCAGGAATCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153803.1-1105s21c1
Sequence:CCGGATGTTACCAGCTATGACTATGCTCGAGCATAGTCATAGCTGGTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks