EMAIL THIS PAGE TO A FRIEND

GLB1L3

galactosidase, beta 1-like 3

64 Gene Product Result for
UniProtKB ID: Q8NCI6, A6NEM0, A6NN15, Q6P3S3, Q96FF8
Gene ID:
Mouse(70893) galactosidase, beta 1 like 3
Rat(500961) galactosidase, beta 1-like 3
domestic guinea pig(100734079) galactosidase, beta 1-like 3
sheep(101115988) galactosidase, beta 1-like 3
domestic cat(101098254) galactosidase, beta 1-like 3
dog(489267) galactosidase, beta 1-like 3
cow(522360) galactosidase, beta 1-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001113323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001113323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001113323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080407 Rosetta Predictions human pricing
NM_001024358 Rosetta Predictions rat pricing
NM_001113323 Rosetta Predictions mouse pricing
XM_983469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314548 predicted 1946
2 SASI_Hs02_00314549 predicted 1934
3 SASI_Hs02_00314550 predicted 1882
4 SASI_Hs02_00314551 predicted 1164
5 SASI_Hs02_00314552 predicted 1099
6 SASI_Hs02_00314553 predicted 1983
7 SASI_Hs02_00314554 predicted 804
8 SASI_Hs02_00314555 predicted 1559
9 SASI_Hs02_00314556 predicted 1333
10 SASI_Hs02_00314557 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202587 predicted 857
2 SASI_Rn01_00085337 predicted 1083
3 SASI_Rn02_00202588 predicted 2079
4 SASI_Rn01_00085338 predicted 1583
5 SASI_Rn01_00085339 predicted 736
6 SASI_Rn01_00085340 predicted 1014
7 SASI_Rn01_00085341 predicted 762
8 SASI_Rn01_00085342 predicted 934
9 SASI_Rn02_00202589 predicted 395
10 SASI_Rn01_00085344 predicted 800
11 SASI_Rn01_00085343 predicted 1067
12 SASI_Rn01_00085345 predicted 325
13 SASI_Rn01_00085346 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307333 predicted 1841
2 SASI_Mm02_00307334 predicted 2224
3 SASI_Mm02_00307335 predicted 1742
4 SASI_Mm02_00307336 predicted 1015
5 SASI_Mm02_00307337 predicted 1293
6 SASI_Mm02_00307338 predicted 1242
7 SASI_Mm02_00307339 predicted 960
8 SASI_Mm02_00307340 predicted 1367
9 SASI_Mm02_00307341 predicted 465
10 SASI_Mm02_00307342 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256689 predicted 2289
2 SASI_Mm01_00256690 predicted 2302
3 SASI_Mm01_00256691 predicted 2240
4 SASI_Mm01_00256692 predicted 2113
5 SASI_Mm01_00256693 predicted 2112
6 SASI_Mm01_00256694 predicted 2169
7 SASI_Mm01_00256695 predicted 2297
8 SASI_Mm01_00256696 predicted 2306
9 SASI_Mm01_00256697 predicted 2103
10 SASI_Mm01_00256698 predicted 2188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113323
GLB1L3 MISSION shRNA Bacterial Glycerol Stock
galactosidase, beta 1-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-2104s21c1
Sequence:CCGGACAATGAGGTTATCGTGTTTGCTCGAGCAAACACGATAACCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-1179s21c1
Sequence:CCGGATTCGACACACAGTATATAAACTCGAGTTTATATACTGTGTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113323.1-2289s21c1
Sequence:CCGGCCCAAAGAAATTGTTACATATCTCGAGATATGTAACAATTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-408s21c1
Sequence:CCGGTTTGTAGGGCTTAGCACTAAACTCGAGTTTAGTGCTAAGCCCTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-2027s21c1
Sequence:CCGGACGCAATCTTGGAAGATATTGCTCGAGCAATATCTTCCAAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113323
GLB1L3 MISSION shRNA shRNA Plasmid DNA
galactosidase, beta 1-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-2104s21c1
Sequence:CCGGACAATGAGGTTATCGTGTTTGCTCGAGCAAACACGATAACCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-1179s21c1
Sequence:CCGGATTCGACACACAGTATATAAACTCGAGTTTATATACTGTGTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113323.1-2289s21c1
Sequence:CCGGCCCAAAGAAATTGTTACATATCTCGAGATATGTAACAATTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-408s21c1
Sequence:CCGGTTTGTAGGGCTTAGCACTAAACTCGAGTTTAGTGCTAAGCCCTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-2027s21c1
Sequence:CCGGACGCAATCTTGGAAGATATTGCTCGAGCAATATCTTCCAAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113323
GLB1L3 MISSION shRNA Lentiviral Transduction Particles
galactosidase, beta 1-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-2104s21c1
Sequence:CCGGACAATGAGGTTATCGTGTTTGCTCGAGCAAACACGATAACCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-1179s21c1
Sequence:CCGGATTCGACACACAGTATATAAACTCGAGTTTATATACTGTGTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113323.1-2289s21c1
Sequence:CCGGCCCAAAGAAATTGTTACATATCTCGAGATATGTAACAATTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-408s21c1
Sequence:CCGGTTTGTAGGGCTTAGCACTAAACTCGAGTTTAGTGCTAAGCCCTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113323.1-2027s21c1
Sequence:CCGGACGCAATCTTGGAAGATATTGCTCGAGCAATATCTTCCAAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138416
GLB1L3 MISSION shRNA Bacterial Glycerol Stock
galactosidase, beta 1-like 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-921s1c1
Sequence:CCGGGACAACCAACAAGAGCTTCATCTCGAGATGAAGCTCTTGTTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138416.1-463s1c1
Sequence:CCGGCAGGAAGAGAACTTCATGCTTCTCGAGAAGCATGAAGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-1204s1c1
Sequence:CCGGCAGGATACTTTCAATCAGCTTCTCGAGAAGCTGATTGAAAGTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-1280s1c1
Sequence:CCGGCAGCAACTTCTTCCTCCTTATCTCGAGATAAGGAGGAAGAAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-909s1c1
Sequence:CCGGGTTACTGTTGAGGACAACCAACTCGAGTTGGTTGTCCTCAACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-705s1c1
Sequence:CCGGCTTCAATACTGTCACCACCTACTCGAGTAGGTGGTGACAGTATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138416
GLB1L3 MISSION shRNA shRNA Plasmid DNA
galactosidase, beta 1-like 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-921s1c1
Sequence:CCGGGACAACCAACAAGAGCTTCATCTCGAGATGAAGCTCTTGTTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138416.1-463s1c1
Sequence:CCGGCAGGAAGAGAACTTCATGCTTCTCGAGAAGCATGAAGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-1204s1c1
Sequence:CCGGCAGGATACTTTCAATCAGCTTCTCGAGAAGCTGATTGAAAGTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-1280s1c1
Sequence:CCGGCAGCAACTTCTTCCTCCTTATCTCGAGATAAGGAGGAAGAAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-909s1c1
Sequence:CCGGGTTACTGTTGAGGACAACCAACTCGAGTTGGTTGTCCTCAACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-705s1c1
Sequence:CCGGCTTCAATACTGTCACCACCTACTCGAGTAGGTGGTGACAGTATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138416
GLB1L3 MISSION shRNA Lentiviral Transduction Particles
galactosidase, beta 1-like 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-921s1c1
Sequence:CCGGGACAACCAACAAGAGCTTCATCTCGAGATGAAGCTCTTGTTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138416.1-463s1c1
Sequence:CCGGCAGGAAGAGAACTTCATGCTTCTCGAGAAGCATGAAGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-1204s1c1
Sequence:CCGGCAGGATACTTTCAATCAGCTTCTCGAGAAGCTGATTGAAAGTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-1280s1c1
Sequence:CCGGCAGCAACTTCTTCCTCCTTATCTCGAGATAAGGAGGAAGAAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-909s1c1
Sequence:CCGGGTTACTGTTGAGGACAACCAACTCGAGTTGGTTGTCCTCAACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138416.1-705s1c1
Sequence:CCGGCTTCAATACTGTCACCACCTACTCGAGTAGGTGGTGACAGTATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks