EMAIL THIS PAGE TO A FRIEND

GLB1L

galactosidase, beta 1-like

45 Gene Product Result for
UniProtKB ID: Q6UWU2, Q96DR0
Gene ID:
Mouse(74577) galactosidase, beta 1-like
Rat(301525) galactosidase, beta 1-like
domestic guinea pig(100735340) galactosidase, beta 1-like
naked mole-rat(101721579) galactosidase, beta 1-like
sheep(101115764) galactosidase, beta 1-like
Zebrafish(100001628) galactosidase, beta 1-like
cow(532551) galactosidase, beta 1-like
Horse(100056223) galactosidase, beta 1-like
chicken(429037) galactosidase, beta 1-like
domestic cat(101096090) galactosidase, beta 1-like
dog(478917) galactosidase, beta 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024506 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024506 Rosetta Predictions human pricing
NM_001127529 Rosetta Predictions rat pricing
XM_217443 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049464 predicted 1943
2 SASI_Hs01_00049465 predicted 727
3 SASI_Hs02_00356775 predicted 1519
4 SASI_Hs01_00049466 predicted 1060
5 SASI_Hs01_00049467 predicted 1297
6 SASI_Hs01_00049468 predicted 1701
7 SASI_Hs01_00049469 predicted 1488
8 SASI_Hs01_00049470 predicted 930
9 SASI_Hs01_00049472 predicted 1225
10 SASI_Hs01_00049473 predicted 1929
11 SASI_Hs01_00049471 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254043 predicted 1556
2 SASI_Rn02_00254044 predicted 1377
3 SASI_Rn02_00254045 predicted 1805
4 SASI_Rn02_00254046 predicted 361
5 SASI_Rn02_00254047 predicted 1507
6 SASI_Rn02_00254048 predicted 970
7 SASI_Rn02_00254049 predicted 603
8 SASI_Rn02_00254050 predicted 1484
9 SASI_Rn02_00254051 predicted 1474
10 SASI_Rn02_00254052 predicted 1726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160629 predicted 240
2 SASI_Rn01_00160630 predicted 262
3 SASI_Rn01_00160631 predicted 236
4 SASI_Rn01_00160632 predicted 231
5 SASI_Rn01_00160633 predicted 219
6 SASI_Rn01_00160634 predicted 236
7 SASI_Rn01_00160635 predicted 215
8 SASI_Rn01_00160636 predicted 225
9 SASI_Rn01_00160637 predicted 232
10 SASI_Rn01_00160638 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024506
GLB1L MISSION shRNA Bacterial Glycerol Stock
galactosidase, beta 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1479s21c1
Sequence:CCGGATGTTGTACCGAACCTATATGCTCGAGCATATAGGTTCGGTACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-821s21c1
Sequence:CCGGCTTCAGCTACATGAGGCACTTCTCGAGAAGTGCCTCATGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024506.3-2269s21c1
Sequence:CCGGGATTACCTGAGGTCAGGACTTCTCGAGAAGTCCTGACCTCAGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1757s21c1
Sequence:CCGGGTGGATGATGTTCCCTCTGAACTCGAGTTCAGAGGGAACATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1013s21c1
Sequence:CCGGGCCATTGGTAAACTCTGAGTACTCGAGTACTCAGAGTTTACCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-821s1c1
Sequence:CCGGCTTCAGCTACATGAGGCACTTCTCGAGAAGTGCCTCATGTAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1757s1c1
Sequence:CCGGGTGGATGATGTTCCCTCTGAACTCGAGTTCAGAGGGAACATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024506.3-2269s1c1
Sequence:CCGGGATTACCTGAGGTCAGGACTTCTCGAGAAGTCCTGACCTCAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1206s1c1
Sequence:CCGGCTTCCGATTACTACCAGCTATCTCGAGATAGCTGGTAGTAATCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1013s1c1
Sequence:CCGGGCCATTGGTAAACTCTGAGTACTCGAGTACTCAGAGTTTACCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024506
GLB1L MISSION shRNA shRNA Plasmid DNA
galactosidase, beta 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1479s21c1
Sequence:CCGGATGTTGTACCGAACCTATATGCTCGAGCATATAGGTTCGGTACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-821s21c1
Sequence:CCGGCTTCAGCTACATGAGGCACTTCTCGAGAAGTGCCTCATGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024506.3-2269s21c1
Sequence:CCGGGATTACCTGAGGTCAGGACTTCTCGAGAAGTCCTGACCTCAGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1757s21c1
Sequence:CCGGGTGGATGATGTTCCCTCTGAACTCGAGTTCAGAGGGAACATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1013s21c1
Sequence:CCGGGCCATTGGTAAACTCTGAGTACTCGAGTACTCAGAGTTTACCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-821s1c1
Sequence:CCGGCTTCAGCTACATGAGGCACTTCTCGAGAAGTGCCTCATGTAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1757s1c1
Sequence:CCGGGTGGATGATGTTCCCTCTGAACTCGAGTTCAGAGGGAACATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024506.3-2269s1c1
Sequence:CCGGGATTACCTGAGGTCAGGACTTCTCGAGAAGTCCTGACCTCAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1206s1c1
Sequence:CCGGCTTCCGATTACTACCAGCTATCTCGAGATAGCTGGTAGTAATCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1013s1c1
Sequence:CCGGGCCATTGGTAAACTCTGAGTACTCGAGTACTCAGAGTTTACCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024506
GLB1L MISSION shRNA Lentiviral Transduction Particles
galactosidase, beta 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1479s21c1
Sequence:CCGGATGTTGTACCGAACCTATATGCTCGAGCATATAGGTTCGGTACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-821s21c1
Sequence:CCGGCTTCAGCTACATGAGGCACTTCTCGAGAAGTGCCTCATGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024506.3-2269s21c1
Sequence:CCGGGATTACCTGAGGTCAGGACTTCTCGAGAAGTCCTGACCTCAGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1757s21c1
Sequence:CCGGGTGGATGATGTTCCCTCTGAACTCGAGTTCAGAGGGAACATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024506.3-1013s21c1
Sequence:CCGGGCCATTGGTAAACTCTGAGTACTCGAGTACTCAGAGTTTACCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-821s1c1
Sequence:CCGGCTTCAGCTACATGAGGCACTTCTCGAGAAGTGCCTCATGTAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1757s1c1
Sequence:CCGGGTGGATGATGTTCCCTCTGAACTCGAGTTCAGAGGGAACATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024506.3-2269s1c1
Sequence:CCGGGATTACCTGAGGTCAGGACTTCTCGAGAAGTCCTGACCTCAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1206s1c1
Sequence:CCGGCTTCCGATTACTACCAGCTATCTCGAGATAGCTGGTAGTAATCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024506.3-1013s1c1
Sequence:CCGGGCCATTGGTAAACTCTGAGTACTCGAGTACTCAGAGTTTACCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks