EMAIL THIS PAGE TO A FRIEND

GLCCI1

glucocorticoid induced transcript 1

219 Gene Product Result for
Synonyms: FAM117C GCTR GIG18 TSSN1
UniProtKB ID: Q86VQ1, A4D103, Q96FD0
Gene ID:
Human(113263) Summary: This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients. [provided by RefSeq, Feb 2012]
Mouse(170772) glucocorticoid induced transcript 1
Rat(296884) glucocorticoid induced transcript 1
Zebrafish(378997) glucocorticoid induced transcript 1
dog(612938) glucocorticoid induced transcript 1
domestic cat(101099704) glucocorticoid induced transcript 1
chicken(420580) glucocorticoid induced transcript 1
cow(541048) glucocorticoid induced transcript 1
sheep(101116138) glucocorticoid induced transcript 1
domestic guinea pig(100725765) glucocorticoid induced transcript 1
naked mole-rat(101708502) glucocorticoid induced transcript 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_379784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138426 Rosetta Predictions human pricing
XM_216096 Rosetta Predictions rat pricing
NM_133236 Rosetta Predictions mouse pricing
NM_178072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051188 predicted 2297
2 SASI_Hs01_00051191 predicted 2180
3 SASI_Hs01_00051190 predicted 1578
4 SASI_Hs01_00051192 predicted 1587
5 SASI_Hs01_00051193 predicted 1267
6 SASI_Hs01_00051194 predicted 1965
7 SASI_Hs01_00051195 predicted 1258
8 SASI_Hs01_00051196 predicted 1707
9 SASI_Hs02_00363576 predicted 2169
10 SASI_Hs02_00363577 predicted 2056
11 SASI_Hs01_00051189 predicted 1291
12 SASI_Hs01_00051197 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147164 predicted 966
2 SASI_Rn01_00147165 predicted 689
3 SASI_Rn01_00147166 predicted 594
4 SASI_Rn01_00147167 predicted 1022
5 SASI_Rn01_00147168 predicted 761
6 SASI_Rn01_00147169 predicted 640
7 SASI_Rn01_00147170 predicted 484
8 SASI_Rn01_00147171 predicted 567
9 SASI_Rn01_00147172 predicted 445
10 SASI_Rn01_00147173 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057854 predicted 1280
2 SASI_Mm02_00338474 predicted 982
3 SASI_Mm02_00338475 predicted 1078
4 SASI_Mm02_00338476 predicted 990
5 SASI_Mm02_00338477 predicted 1416
6 SASI_Mm02_00338478 predicted 1484
7 SASI_Mm01_00057857 predicted 1156
8 SASI_Mm02_00338479 predicted 1743
9 SASI_Mm02_00338480 predicted 1068
10 SASI_Mm02_00338481 predicted 1537
11 SASI_Mm01_00057855 predicted 1030
12 SASI_Mm01_00057856 predicted 984
13 SASI_Mm01_00057858 predicted 990
14 SASI_Mm01_00057859 predicted 973
15 SASI_Mm01_00057860 predicted 954
16 SASI_Mm01_00057861 predicted 1030
17 SASI_Mm01_00057862 predicted 1020
18 SASI_Mm01_00057863 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033853 predicted 903
2 SASI_Mm01_00033854 predicted 933
3 SASI_Mm01_00033855 predicted 881
4 SASI_Mm01_00033856 predicted 787
5 SASI_Mm01_00033857 predicted 889
6 SASI_Mm01_00033858 predicted 884
7 SASI_Mm01_00033859 predicted 854
8 SASI_Mm01_00033860 predicted 926
9 SASI_Mm01_00033861 predicted 927
10 SASI_Mm01_00033862 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138426
VALIDATED
GLCCI1 MISSION shRNA Bacterial Glycerol Stock
glucocorticoid induced transcript 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138426.1-1394s1c1
Sequence:CCGGCCTATGCCACTGTCAAATATACTCGAGTATATTTGACAGTGGCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138426.1-2729s1c1
Sequence:CCGGCTCAGGTAACTTGGAATGTATCTCGAGATACATTCCAAGTTACCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138426.1-1143s1c1
Sequence:CCGGCATGCATGAAAGACAAAGCTACTCGAGTAGCTTTGTCTTTCATGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138426.1-1593s1c1
Sequence:CCGGGCATTGACACTCAGACTCCTTCTCGAGAAGGAGTCTGAGTGTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138426.1-2057s1c1
Sequence:CCGGCGGGTTTCCTTTACGTCTCTTCTCGAGAAGAGACGTAAAGGAAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1274s21c1
Sequence:CCGGCAGCAACTACAACGCAGTAAACTCGAGTTTACTGCGTTGTAGTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1335s21c1
Sequence:CCGGCTCTTCATGGCAACCATATAACTCGAGTTATATGGTTGCCATGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1827s21c1
Sequence:CCGGGTGAGCGAGTGAAGGTCTTTGCTCGAGCAAAGACCTTCACTCGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138426
VALIDATED
GLCCI1 MISSION shRNA shRNA Plasmid DNA
glucocorticoid induced transcript 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138426.1-1394s1c1
Sequence:CCGGCCTATGCCACTGTCAAATATACTCGAGTATATTTGACAGTGGCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138426.1-2729s1c1
Sequence:CCGGCTCAGGTAACTTGGAATGTATCTCGAGATACATTCCAAGTTACCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138426.1-1143s1c1
Sequence:CCGGCATGCATGAAAGACAAAGCTACTCGAGTAGCTTTGTCTTTCATGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138426.1-1593s1c1
Sequence:CCGGGCATTGACACTCAGACTCCTTCTCGAGAAGGAGTCTGAGTGTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138426.1-2057s1c1
Sequence:CCGGCGGGTTTCCTTTACGTCTCTTCTCGAGAAGAGACGTAAAGGAAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1274s21c1
Sequence:CCGGCAGCAACTACAACGCAGTAAACTCGAGTTTACTGCGTTGTAGTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1335s21c1
Sequence:CCGGCTCTTCATGGCAACCATATAACTCGAGTTATATGGTTGCCATGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1827s21c1
Sequence:CCGGGTGAGCGAGTGAAGGTCTTTGCTCGAGCAAAGACCTTCACTCGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138426
VALIDATED
GLCCI1 MISSION shRNA Lentiviral Transduction Particles
glucocorticoid induced transcript 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138426.1-1394s1c1
Sequence:CCGGCCTATGCCACTGTCAAATATACTCGAGTATATTTGACAGTGGCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138426.1-2729s1c1
Sequence:CCGGCTCAGGTAACTTGGAATGTATCTCGAGATACATTCCAAGTTACCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138426.1-1143s1c1
Sequence:CCGGCATGCATGAAAGACAAAGCTACTCGAGTAGCTTTGTCTTTCATGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138426.1-1593s1c1
Sequence:CCGGGCATTGACACTCAGACTCCTTCTCGAGAAGGAGTCTGAGTGTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138426.1-2057s1c1
Sequence:CCGGCGGGTTTCCTTTACGTCTCTTCTCGAGAAGAGACGTAAAGGAAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1274s21c1
Sequence:CCGGCAGCAACTACAACGCAGTAAACTCGAGTTTACTGCGTTGTAGTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1335s21c1
Sequence:CCGGCTCTTCATGGCAACCATATAACTCGAGTTATATGGTTGCCATGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138426.2-1827s21c1
Sequence:CCGGGTGAGCGAGTGAAGGTCTTTGCTCGAGCAAAGACCTTCACTCGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133236
GLCCI1 MISSION shRNA Bacterial Glycerol Stock
glucocorticoid induced transcript 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-1601s1c1
Sequence:CCGGCACTCAGAACTATGTGATGATCTCGAGATCATCACATAGTTCTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133236.1-1184s1c1
Sequence:CCGGCAAGTATGCTTCATCTCCCAACTCGAGTTGGGAGATGAAGCATACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-761s1c1
Sequence:CCGGCCATGGCAACCACATAACAATCTCGAGATTGTTATGTGGTTGCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-1177s1c1
Sequence:CCGGCGTTACCCAAGTATGCTTCATCTCGAGATGAAGCATACTTGGGTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133236.1-1778s1c1
Sequence:CCGGCCGACTTATATTCAGCAGTTTCTCGAGAAACTGCTGAATATAAGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133236.1-4266s1c1
Sequence:CCGGCGCTCTAAATAGTGGTCATATCTCGAGATATGACCACTATTTAGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133236.2-1000s21c1
Sequence:CCGGCAAAGTAGTCGGCATAGTAAACTCGAGTTTACTATGCCGACTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133236.2-2202s21c1
Sequence:CCGGCAGTATGAATAAGCTCTATTTCTCGAGAAATAGAGCTTATTCATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133236.2-1100s1c1
Sequence:CCGGCTATGCCTCTGTCAAACATATCTCGAGATATGTTTGACAGAGGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133236
GLCCI1 MISSION shRNA shRNA Plasmid DNA
glucocorticoid induced transcript 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-1601s1c1
Sequence:CCGGCACTCAGAACTATGTGATGATCTCGAGATCATCACATAGTTCTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133236.1-1184s1c1
Sequence:CCGGCAAGTATGCTTCATCTCCCAACTCGAGTTGGGAGATGAAGCATACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-761s1c1
Sequence:CCGGCCATGGCAACCACATAACAATCTCGAGATTGTTATGTGGTTGCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-1177s1c1
Sequence:CCGGCGTTACCCAAGTATGCTTCATCTCGAGATGAAGCATACTTGGGTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133236.1-1778s1c1
Sequence:CCGGCCGACTTATATTCAGCAGTTTCTCGAGAAACTGCTGAATATAAGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133236.1-4266s1c1
Sequence:CCGGCGCTCTAAATAGTGGTCATATCTCGAGATATGACCACTATTTAGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133236.2-1000s21c1
Sequence:CCGGCAAAGTAGTCGGCATAGTAAACTCGAGTTTACTATGCCGACTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133236.2-2202s21c1
Sequence:CCGGCAGTATGAATAAGCTCTATTTCTCGAGAAATAGAGCTTATTCATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133236.2-1100s1c1
Sequence:CCGGCTATGCCTCTGTCAAACATATCTCGAGATATGTTTGACAGAGGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133236
GLCCI1 MISSION shRNA Lentiviral Transduction Particles
glucocorticoid induced transcript 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-1601s1c1
Sequence:CCGGCACTCAGAACTATGTGATGATCTCGAGATCATCACATAGTTCTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133236.1-1184s1c1
Sequence:CCGGCAAGTATGCTTCATCTCCCAACTCGAGTTGGGAGATGAAGCATACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-761s1c1
Sequence:CCGGCCATGGCAACCACATAACAATCTCGAGATTGTTATGTGGTTGCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133236.1-1177s1c1
Sequence:CCGGCGTTACCCAAGTATGCTTCATCTCGAGATGAAGCATACTTGGGTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133236.1-1778s1c1
Sequence:CCGGCCGACTTATATTCAGCAGTTTCTCGAGAAACTGCTGAATATAAGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133236.1-4266s1c1
Sequence:CCGGCGCTCTAAATAGTGGTCATATCTCGAGATATGACCACTATTTAGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133236.2-1000s21c1
Sequence:CCGGCAAAGTAGTCGGCATAGTAAACTCGAGTTTACTATGCCGACTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133236.2-2202s21c1
Sequence:CCGGCAGTATGAATAAGCTCTATTTCTCGAGAAATAGAGCTTATTCATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133236.2-1100s1c1
Sequence:CCGGCTATGCCTCTGTCAAACATATCTCGAGATATGTTTGACAGAGGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379784
VALIDATED
GLCCI1 MISSION shRNA Bacterial Glycerol Stock
glucocorticoid induced transcript 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000121648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379784.1-3707s1c1
Sequence:CCGGGCCTAAAGTGTATGGCACAATCTCGAGATTGTGCCATACACTTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379784.1-1696s1c1
Sequence:CCGGCCCTTGCTCAACAGAAGATTTCTCGAGAAATCTTCTGTTGAGCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379784
VALIDATED
GLCCI1 MISSION shRNA shRNA Plasmid DNA
glucocorticoid induced transcript 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000121648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379784.1-3707s1c1
Sequence:CCGGGCCTAAAGTGTATGGCACAATCTCGAGATTGTGCCATACACTTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379784.1-1696s1c1
Sequence:CCGGCCCTTGCTCAACAGAAGATTTCTCGAGAAATCTTCTGTTGAGCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379784
VALIDATED
GLCCI1 MISSION shRNA Lentiviral Transduction Particles
glucocorticoid induced transcript 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000121648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379784.1-3707s1c1
Sequence:CCGGGCCTAAAGTGTATGGCACAATCTCGAGATTGTGCCATACACTTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379784.1-1696s1c1
Sequence:CCGGCCCTTGCTCAACAGAAGATTTCTCGAGAAATCTTCTGTTGAGCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)