EMAIL THIS PAGE TO A FRIEND

GLCE

glucuronic acid epimerase

177 Gene Product Result for
Synonyms: HSEPI
UniProtKB ID: O94923, Q6GUQ2
Gene ID:
Human(26035) Summary: Heparan sulfate (HS) is a negatively charged cell surface polysaccharide required for the biologic activities of circulating extracellular ligands. GLCE is responsible for epimerization of D-glucuronic acid (GlcA) to L-iduronic acid (IdoA) of HS, which endows the nascent polysaccharide chain with the ability to bind growth factors and cytokines (Ghiselli and Agrawal, 2005 [PubMed 15853773]
Mouse(93683) glucuronyl C5-epimerase
Rat(363073) glucuronic acid epimerase
domestic guinea pig(100733856) glucuronic acid epimerase
naked mole-rat(101703064) glucuronic acid epimerase
sheep(101106592) glucuronic acid epimerase
chicken(415566) glucuronic acid epimerase
domestic cat(101095983) glucuronic acid epimerase
cow(281195) glucuronic acid epimerase
Horse(100052581) glucuronic acid epimerase
dog(487622) glucuronic acid epimerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015554 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015554 Rosetta Predictions human pricing
XM_001073932 Rosetta Predictions rat pricing
XM_343404 Rosetta Predictions rat pricing
NM_033320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348092 predicted 1542
2 SASI_Hs01_00169325 predicted 1495
3 SASI_Hs01_00169326 predicted 2067
4 SASI_Hs02_00348093 predicted 914
5 SASI_Hs01_00169328 predicted 1835
6 SASI_Hs01_00169330 predicted 1623
7 SASI_Hs01_00169331 predicted 1451
8 SASI_Hs02_00348094 predicted 1190
9 SASI_Hs01_00169332 predicted 512
10 SASI_Hs02_00348095 predicted 2049
11 SASI_Hs01_00169323 predicted 258
12 SASI_Hs01_00169324 predicted 1680
13 SASI_Hs01_00169327 predicted 689
14 SASI_Hs01_00169329 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344435 predicted 1748
2 SASI_Rn02_00344436 predicted 295
3 SASI_Rn02_00344437 predicted 710
4 SASI_Rn02_00344438 predicted 882
5 SASI_Rn02_00344439 predicted 1914
6 SASI_Rn02_00344440 predicted 1627
7 SASI_Rn02_00344441 predicted 1513
8 SASI_Rn02_00344442 predicted 1132
9 SASI_Rn02_00344443 predicted 529
10 SASI_Rn02_00344444 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395744 predicted 1744
2 SASI_Rn02_00395745 predicted 288
3 SASI_Rn02_00395746 predicted 711
4 SASI_Rn02_00395747 predicted 882
5 SASI_Rn02_00395748 predicted 1918
6 SASI_Rn02_00395749 predicted 1630
7 SASI_Rn02_00395750 predicted 1515
8 SASI_Rn02_00395751 predicted 1124
9 SASI_Rn02_00395752 predicted 527
10 SASI_Rn02_00395753 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065708 predicted 1367
2 SASI_Mm01_00065709 predicted 796
3 SASI_Mm01_00065710 predicted 439
4 SASI_Mm01_00065711 predicted 644
5 SASI_Mm01_00065712 predicted 491
6 SASI_Mm01_00065713 predicted 1680
7 SASI_Mm01_00065715 predicted 1853
8 SASI_Mm02_00337328 predicted 643
9 SASI_Mm01_00065716 predicted 1270
10 SASI_Mm01_00065717 predicted 1386
11 SASI_Mm01_00065714 predicted 1465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015554
VALIDATED
GLCE MISSION shRNA Bacterial Glycerol Stock
glucuronic acid epimerase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-999s21c1
Sequence:CCGGTATGGCGAATGTGGCTGATAACTCGAGTTATCAGCCACATTCGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-866s21c1
Sequence:CCGGAGATTGCACAGTATGGATTAACTCGAGTTAATCCATACTGTGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-1775s21c1
Sequence:CCGGTAATTGGGCTGTATGACTTAACTCGAGTTAAGTCATACAGCCCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-544s21c1
Sequence:CCGGGAAATTGACTGTCTCATAAATCTCGAGATTTATGAGACAGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-1391s21c1
Sequence:CCGGAGGGATTCCTCGACAACATTACTCGAGTAATGTTGTCGAGGAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-518s21c1
Sequence:CCGGGTAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-4349s1c1
Sequence:CCGGGCCTCTAAACAACTACAGAATCTCGAGATTCTGTAGTTGTTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-1677s1c1
Sequence:CCGGGCATGGAGTTAAAGCTGTGTTCTCGAGAACACAGCTTTAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015554.1-919s1c1
Sequence:CCGGCCTCACATAGAGGTATATGAACTCGAGTTCATATACCTCTATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015554.1-1494s1c1
Sequence:CCGGGCCAATTATGGTGACCCGTAACTCGAGTTACGGGTCACCATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-781s1c1
Sequence:CCGGCGAGACAGAGTCAAGTGCATACTCGAGTATGCACTTGACTCTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015554
VALIDATED
GLCE MISSION shRNA shRNA Plasmid DNA
glucuronic acid epimerase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-999s21c1
Sequence:CCGGTATGGCGAATGTGGCTGATAACTCGAGTTATCAGCCACATTCGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-866s21c1
Sequence:CCGGAGATTGCACAGTATGGATTAACTCGAGTTAATCCATACTGTGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-1775s21c1
Sequence:CCGGTAATTGGGCTGTATGACTTAACTCGAGTTAAGTCATACAGCCCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-544s21c1
Sequence:CCGGGAAATTGACTGTCTCATAAATCTCGAGATTTATGAGACAGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-1391s21c1
Sequence:CCGGAGGGATTCCTCGACAACATTACTCGAGTAATGTTGTCGAGGAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-518s21c1
Sequence:CCGGGTAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-4349s1c1
Sequence:CCGGGCCTCTAAACAACTACAGAATCTCGAGATTCTGTAGTTGTTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-1677s1c1
Sequence:CCGGGCATGGAGTTAAAGCTGTGTTCTCGAGAACACAGCTTTAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015554.1-919s1c1
Sequence:CCGGCCTCACATAGAGGTATATGAACTCGAGTTCATATACCTCTATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015554.1-1494s1c1
Sequence:CCGGGCCAATTATGGTGACCCGTAACTCGAGTTACGGGTCACCATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-781s1c1
Sequence:CCGGCGAGACAGAGTCAAGTGCATACTCGAGTATGCACTTGACTCTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015554
VALIDATED
GLCE MISSION shRNA Lentiviral Transduction Particles
glucuronic acid epimerase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-999s21c1
Sequence:CCGGTATGGCGAATGTGGCTGATAACTCGAGTTATCAGCCACATTCGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-866s21c1
Sequence:CCGGAGATTGCACAGTATGGATTAACTCGAGTTAATCCATACTGTGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-1775s21c1
Sequence:CCGGTAATTGGGCTGTATGACTTAACTCGAGTTAAGTCATACAGCCCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-544s21c1
Sequence:CCGGGAAATTGACTGTCTCATAAATCTCGAGATTTATGAGACAGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-1391s21c1
Sequence:CCGGAGGGATTCCTCGACAACATTACTCGAGTAATGTTGTCGAGGAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015554.1-518s21c1
Sequence:CCGGGTAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-4349s1c1
Sequence:CCGGGCCTCTAAACAACTACAGAATCTCGAGATTCTGTAGTTGTTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-1677s1c1
Sequence:CCGGGCATGGAGTTAAAGCTGTGTTCTCGAGAACACAGCTTTAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015554.1-919s1c1
Sequence:CCGGCCTCACATAGAGGTATATGAACTCGAGTTCATATACCTCTATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015554.1-1494s1c1
Sequence:CCGGGCCAATTATGGTGACCCGTAACTCGAGTTACGGGTCACCATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015554.1-781s1c1
Sequence:CCGGCGAGACAGAGTCAAGTGCATACTCGAGTATGCACTTGACTCTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033320
VALIDATED
GLCE MISSION shRNA Bacterial Glycerol Stock
glucuronic acid epimerase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033320.4-2604s21c1
Sequence:CCGGGCTGCATTTCATTTCATACTACTCGAGTAGTATGAAATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-296s21c1
Sequence:CCGGGCAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-809s21c1
Sequence:CCGGCCACCAATGTTAAACAGTTTACTCGAGTAAACTGTTTAACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-1627s21c1
Sequence:CCGGCGCGGCATGGAATCTCTTAAACTCGAGTTTAAGAGATTCCATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-809s1c1
Sequence:CCGGCCACCAATGTTAAACAGTTTACTCGAGTAAACTGTTTAACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-2604s1c1
Sequence:CCGGGCTGCATTTCATTTCATACTACTCGAGTAGTATGAAATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-1458s1c1
Sequence:CCGGGCATGGAGTTAAAGCCGTGTTCTCGAGAACACGGCTTTAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-296s1c1
Sequence:CCGGGCAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-1627s1c1
Sequence:CCGGCGCGGCATGGAATCTCTTAAACTCGAGTTTAAGAGATTCCATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033320
VALIDATED
GLCE MISSION shRNA shRNA Plasmid DNA
glucuronic acid epimerase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033320.4-2604s21c1
Sequence:CCGGGCTGCATTTCATTTCATACTACTCGAGTAGTATGAAATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-296s21c1
Sequence:CCGGGCAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-809s21c1
Sequence:CCGGCCACCAATGTTAAACAGTTTACTCGAGTAAACTGTTTAACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-1627s21c1
Sequence:CCGGCGCGGCATGGAATCTCTTAAACTCGAGTTTAAGAGATTCCATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-809s1c1
Sequence:CCGGCCACCAATGTTAAACAGTTTACTCGAGTAAACTGTTTAACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-2604s1c1
Sequence:CCGGGCTGCATTTCATTTCATACTACTCGAGTAGTATGAAATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-1458s1c1
Sequence:CCGGGCATGGAGTTAAAGCCGTGTTCTCGAGAACACGGCTTTAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-296s1c1
Sequence:CCGGGCAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-1627s1c1
Sequence:CCGGCGCGGCATGGAATCTCTTAAACTCGAGTTTAAGAGATTCCATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033320
VALIDATED
GLCE MISSION shRNA Lentiviral Transduction Particles
glucuronic acid epimerase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033320.4-2604s21c1
Sequence:CCGGGCTGCATTTCATTTCATACTACTCGAGTAGTATGAAATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-296s21c1
Sequence:CCGGGCAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-809s21c1
Sequence:CCGGCCACCAATGTTAAACAGTTTACTCGAGTAAACTGTTTAACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033320.4-1627s21c1
Sequence:CCGGCGCGGCATGGAATCTCTTAAACTCGAGTTTAAGAGATTCCATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-809s1c1
Sequence:CCGGCCACCAATGTTAAACAGTTTACTCGAGTAAACTGTTTAACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-2604s1c1
Sequence:CCGGGCTGCATTTCATTTCATACTACTCGAGTAGTATGAAATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-1458s1c1
Sequence:CCGGGCATGGAGTTAAAGCCGTGTTCTCGAGAACACGGCTTTAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-296s1c1
Sequence:CCGGGCAAGGTGTTAGGGCTCAAATCTCGAGATTTGAGCCCTAACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033320.3-1627s1c1
Sequence:CCGGCGCGGCATGGAATCTCTTAAACTCGAGTTTAAGAGATTCCATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks