EMAIL THIS PAGE TO A FRIEND

GLDC

glycine dehydrogenase (decarboxylating)

91 Gene Product Result for
Synonyms: GCE GCSP HYGN1
UniProtKB ID: P23378, Q2M2F8
Gene ID:
Human(2731) Summary: Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
Mouse(104174) glycine decarboxylase
Rat(309312) glycine dehydrogenase (decarboxylating)
Zebrafish(321621) glycine dehydrogenase (decarboxylating)
domestic cat(101100163) glycine dehydrogenase (decarboxylating)
cow(507688) glycine dehydrogenase (decarboxylating)
Horse(100060355) glycine dehydrogenase (decarboxylating)
dog(481534) glycine dehydrogenase (decarboxylating)
chicken(374222) glycine dehydrogenase (decarboxylating)
sheep(101117476) glycine dehydrogenase (decarboxylating)
Domestic Rabbit(100343694) glycine dehydrogenase (decarboxylating)
domestic guinea pig(100714862) glycine dehydrogenase (decarboxylating)
naked mole-rat(101725465) glycine dehydrogenase (decarboxylating)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000170 Rosetta Predictions human pricing
NM_001107583 Rosetta Predictions rat pricing
NM_138595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155729 predicted 2752
2 SASI_Hs01_00155730 predicted 1941
3 SASI_Hs02_00302003 predicted 1200
4 SASI_Hs01_00155732 predicted 2004
5 SASI_Hs02_00302004 predicted 2622
6 SASI_Hs01_00155733 predicted 1264
7 SASI_Hs01_00155734 predicted 1787
8 SASI_Hs01_00155735 predicted 836
9 SASI_Hs01_00155736 predicted 2712
10 SASI_Hs01_00155737 predicted 3136
11 SASI_Hs01_00155731 predicted 1591
12 SASI_Hs01_00155738 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230265 predicted 2711
2 SASI_Rn02_00230266 predicted 1306
3 SASI_Rn02_00230267 predicted 625
4 SASI_Rn02_00230268 predicted 2173
5 SASI_Rn02_00230269 predicted 1485
6 SASI_Rn02_00230270 predicted 2334
7 SASI_Rn02_00230271 predicted 1709
8 SASI_Rn02_00230272 predicted 2089
9 SASI_Rn02_00230273 predicted 1753
10 SASI_Rn02_00230274 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339661 predicted 2265
2 SASI_Mm01_00159257 predicted 2393
3 SASI_Mm01_00159258 predicted 1531
4 SASI_Mm01_00159260 predicted 1801
5 SASI_Mm01_00159261 predicted 2603
6 SASI_Mm01_00159262 predicted 2268
7 SASI_Mm01_00159263 predicted 2182
8 SASI_Mm02_00339662 predicted 1743
9 SASI_Mm01_00159264 predicted 2734
10 SASI_Mm01_00159265 predicted 3189
11 SASI_Mm01_00159259 predicted 3112
12 SASI_Mm01_00159266 predicted 2681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000170
VALIDATED
GLDC MISSION shRNA Bacterial Glycerol Stock
glycine dehydrogenase (decarboxylating)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-2038s1c1
Sequence:CCGGCGAGCCTACTTAAACCAGAAACTCGAGTTTCTGGTTTAAGTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-2636s1c1
Sequence:CCGGCCACGGAAACTGCGATATTAACTCGAGTTAATATCGCAGTTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-1213s1c1
Sequence:CCGGGCCACTGGGAAAGAAGTGTATCTCGAGATACACTTCTTTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-3166s1c1
Sequence:CCGGGAAGTTTATGAGTCTCCATTTCTCGAGAAATGGAGACTCATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000170.1-436s1c1
Sequence:CCGGCCTGCCAACATCCGTTTGAAACTCGAGTTTCAAACGGATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-2081s21c1
Sequence:CCGGCGAGCCTACTTAAACCAGAAACTCGAGTTTCTGGTTTAAGTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-591s21c1
Sequence:CCGGATATTGGCATGGGCTATTATACTCGAGTATAATAGCCCATGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-3209s21c1
Sequence:CCGGGAAGTTTATGAGTCTCCATTTCTCGAGAAATGGAGACTCATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-1256s21c1
Sequence:CCGGGCCACTGGGAAAGAAGTGTATCTCGAGATACACTTCTTTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000170.2-3378s21c1
Sequence:CCGGTGTAATCTCTGTCAAGGTAAACTCGAGTTTACCTTGACAGAGATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000170
VALIDATED
GLDC MISSION shRNA shRNA Plasmid DNA
glycine dehydrogenase (decarboxylating)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-2038s1c1
Sequence:CCGGCGAGCCTACTTAAACCAGAAACTCGAGTTTCTGGTTTAAGTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-2636s1c1
Sequence:CCGGCCACGGAAACTGCGATATTAACTCGAGTTAATATCGCAGTTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-1213s1c1
Sequence:CCGGGCCACTGGGAAAGAAGTGTATCTCGAGATACACTTCTTTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-3166s1c1
Sequence:CCGGGAAGTTTATGAGTCTCCATTTCTCGAGAAATGGAGACTCATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000170.1-436s1c1
Sequence:CCGGCCTGCCAACATCCGTTTGAAACTCGAGTTTCAAACGGATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-2081s21c1
Sequence:CCGGCGAGCCTACTTAAACCAGAAACTCGAGTTTCTGGTTTAAGTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-591s21c1
Sequence:CCGGATATTGGCATGGGCTATTATACTCGAGTATAATAGCCCATGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-3209s21c1
Sequence:CCGGGAAGTTTATGAGTCTCCATTTCTCGAGAAATGGAGACTCATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-1256s21c1
Sequence:CCGGGCCACTGGGAAAGAAGTGTATCTCGAGATACACTTCTTTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000170.2-3378s21c1
Sequence:CCGGTGTAATCTCTGTCAAGGTAAACTCGAGTTTACCTTGACAGAGATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000170
VALIDATED
GLDC MISSION shRNA Lentiviral Transduction Particles
glycine dehydrogenase (decarboxylating)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-2038s1c1
Sequence:CCGGCGAGCCTACTTAAACCAGAAACTCGAGTTTCTGGTTTAAGTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-2636s1c1
Sequence:CCGGCCACGGAAACTGCGATATTAACTCGAGTTAATATCGCAGTTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-1213s1c1
Sequence:CCGGGCCACTGGGAAAGAAGTGTATCTCGAGATACACTTCTTTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000170.1-3166s1c1
Sequence:CCGGGAAGTTTATGAGTCTCCATTTCTCGAGAAATGGAGACTCATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000170.1-436s1c1
Sequence:CCGGCCTGCCAACATCCGTTTGAAACTCGAGTTTCAAACGGATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-2081s21c1
Sequence:CCGGCGAGCCTACTTAAACCAGAAACTCGAGTTTCTGGTTTAAGTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-591s21c1
Sequence:CCGGATATTGGCATGGGCTATTATACTCGAGTATAATAGCCCATGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-3209s21c1
Sequence:CCGGGAAGTTTATGAGTCTCCATTTCTCGAGAAATGGAGACTCATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000170.2-1256s21c1
Sequence:CCGGGCCACTGGGAAAGAAGTGTATCTCGAGATACACTTCTTTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000170.2-3378s21c1
Sequence:CCGGTGTAATCTCTGTCAAGGTAAACTCGAGTTTACCTTGACAGAGATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138595
GLDC MISSION shRNA Bacterial Glycerol Stock
glycine dehydrogenase (decarboxylating)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138595.1-3609s1c1
Sequence:CCGGCCAGGGCAAATGTTTACATTTCTCGAGAAATGTAAACATTTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-689s1c1
Sequence:CCGGGCTGGAGAGTTTACTCAACTACTCGAGTAGTTGAGTAAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-2658s1c1
Sequence:CCGGGCCACAGAAATCGCCATTCTACTCGAGTAGAATGGCGATTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-2659s1c1
Sequence:CCGGCCACAGAAATCGCCATTCTAACTCGAGTTAGAATGGCGATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138595
GLDC MISSION shRNA shRNA Plasmid DNA
glycine dehydrogenase (decarboxylating)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138595.1-3609s1c1
Sequence:CCGGCCAGGGCAAATGTTTACATTTCTCGAGAAATGTAAACATTTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-689s1c1
Sequence:CCGGGCTGGAGAGTTTACTCAACTACTCGAGTAGTTGAGTAAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-2658s1c1
Sequence:CCGGGCCACAGAAATCGCCATTCTACTCGAGTAGAATGGCGATTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-2659s1c1
Sequence:CCGGCCACAGAAATCGCCATTCTAACTCGAGTTAGAATGGCGATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138595
GLDC MISSION shRNA Lentiviral Transduction Particles
glycine dehydrogenase (decarboxylating)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138595.1-3609s1c1
Sequence:CCGGCCAGGGCAAATGTTTACATTTCTCGAGAAATGTAAACATTTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-689s1c1
Sequence:CCGGGCTGGAGAGTTTACTCAACTACTCGAGTAGTTGAGTAAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-2658s1c1
Sequence:CCGGGCCACAGAAATCGCCATTCTACTCGAGTAGAATGGCGATTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138595.1-2659s1c1
Sequence:CCGGCCACAGAAATCGCCATTCTAACTCGAGTTAGAATGGCGATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks